ID: 1014274170

View in Genome Browser
Species Human (GRCh38)
Location 6:119368101-119368123
Sequence CAGGACTACTAGAAGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014274165_1014274170 18 Left 1014274165 6:119368060-119368082 CCATGAGGTATACATGGATATAA No data
Right 1014274170 6:119368101-119368123 CAGGACTACTAGAAGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014274170 Original CRISPR CAGGACTACTAGAAGCAGGA GGG Intergenic
No off target data available for this crispr