ID: 1014279832

View in Genome Browser
Species Human (GRCh38)
Location 6:119429466-119429488
Sequence GTCACTGACCTACCTAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014279832_1014279835 -5 Left 1014279832 6:119429466-119429488 CCATCCTTAGGTAGGTCAGTGAC No data
Right 1014279835 6:119429484-119429506 GTGACCTTGAGCAGCCTCATGGG No data
1014279832_1014279834 -6 Left 1014279832 6:119429466-119429488 CCATCCTTAGGTAGGTCAGTGAC No data
Right 1014279834 6:119429483-119429505 AGTGACCTTGAGCAGCCTCATGG No data
1014279832_1014279838 13 Left 1014279832 6:119429466-119429488 CCATCCTTAGGTAGGTCAGTGAC No data
Right 1014279838 6:119429502-119429524 ATGGGAGAACTCTGTCTAGCAGG No data
1014279832_1014279839 27 Left 1014279832 6:119429466-119429488 CCATCCTTAGGTAGGTCAGTGAC No data
Right 1014279839 6:119429516-119429538 TCTAGCAGGAATGCTCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014279832 Original CRISPR GTCACTGACCTACCTAAGGA TGG (reversed) Intergenic
No off target data available for this crispr