ID: 1014281366

View in Genome Browser
Species Human (GRCh38)
Location 6:119445666-119445688
Sequence TAATAGGGATCCAGCTTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014281359_1014281366 9 Left 1014281359 6:119445634-119445656 CCTCTTGAACCTGATACCATCCC No data
Right 1014281366 6:119445666-119445688 TAATAGGGATCCAGCTTGACAGG No data
1014281360_1014281366 0 Left 1014281360 6:119445643-119445665 CCTGATACCATCCCTAATGAAGT No data
Right 1014281366 6:119445666-119445688 TAATAGGGATCCAGCTTGACAGG No data
1014281361_1014281366 -7 Left 1014281361 6:119445650-119445672 CCATCCCTAATGAAGTTAATAGG No data
Right 1014281366 6:119445666-119445688 TAATAGGGATCCAGCTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014281366 Original CRISPR TAATAGGGATCCAGCTTGAC AGG Intergenic
No off target data available for this crispr