ID: 1014281409

View in Genome Browser
Species Human (GRCh38)
Location 6:119446013-119446035
Sequence TAGGAGAGGGCTGATGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014281409_1014281418 22 Left 1014281409 6:119446013-119446035 CCCACCTCATCAGCCCTCTCCTA No data
Right 1014281418 6:119446058-119446080 CACTGAAACTGCCTTTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014281409 Original CRISPR TAGGAGAGGGCTGATGAGGT GGG (reversed) Intergenic
No off target data available for this crispr