ID: 1014282343

View in Genome Browser
Species Human (GRCh38)
Location 6:119455753-119455775
Sequence TAAAGATTACCCATGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014282343_1014282347 16 Left 1014282343 6:119455753-119455775 CCTGCTTCCATGGGTAATCTTTA No data
Right 1014282347 6:119455792-119455814 GATTTCTCCCTGCTCCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014282343 Original CRISPR TAAAGATTACCCATGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr