ID: 1014286363

View in Genome Browser
Species Human (GRCh38)
Location 6:119503442-119503464
Sequence CTCAATTCCCACATGGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014286363_1014286371 11 Left 1014286363 6:119503442-119503464 CCTTTCCCCATGTGGGAATTGAG No data
Right 1014286371 6:119503476-119503498 CTCTTCTAGTTCATCCCACAGGG No data
1014286363_1014286377 29 Left 1014286363 6:119503442-119503464 CCTTTCCCCATGTGGGAATTGAG No data
Right 1014286377 6:119503494-119503516 CAGGGACTCAGTGGGGTGTGAGG No data
1014286363_1014286372 20 Left 1014286363 6:119503442-119503464 CCTTTCCCCATGTGGGAATTGAG No data
Right 1014286372 6:119503485-119503507 TTCATCCCACAGGGACTCAGTGG No data
1014286363_1014286370 10 Left 1014286363 6:119503442-119503464 CCTTTCCCCATGTGGGAATTGAG No data
Right 1014286370 6:119503475-119503497 CCTCTTCTAGTTCATCCCACAGG No data
1014286363_1014286374 22 Left 1014286363 6:119503442-119503464 CCTTTCCCCATGTGGGAATTGAG No data
Right 1014286374 6:119503487-119503509 CATCCCACAGGGACTCAGTGGGG No data
1014286363_1014286373 21 Left 1014286363 6:119503442-119503464 CCTTTCCCCATGTGGGAATTGAG No data
Right 1014286373 6:119503486-119503508 TCATCCCACAGGGACTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014286363 Original CRISPR CTCAATTCCCACATGGGGAA AGG (reversed) Intergenic
No off target data available for this crispr