ID: 1014293393

View in Genome Browser
Species Human (GRCh38)
Location 6:119587836-119587858
Sequence CTGTAGGCACACCTTGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014293393_1014293397 19 Left 1014293393 6:119587836-119587858 CCATATTCAAGGTGTGCCTACAG No data
Right 1014293397 6:119587878-119587900 GGTTAGCACCCAGCAACTCCTGG No data
1014293393_1014293398 20 Left 1014293393 6:119587836-119587858 CCATATTCAAGGTGTGCCTACAG No data
Right 1014293398 6:119587879-119587901 GTTAGCACCCAGCAACTCCTGGG No data
1014293393_1014293395 -2 Left 1014293393 6:119587836-119587858 CCATATTCAAGGTGTGCCTACAG No data
Right 1014293395 6:119587857-119587879 AGCTTCCAGTGTTCTGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014293393 Original CRISPR CTGTAGGCACACCTTGAATA TGG (reversed) Intergenic
No off target data available for this crispr