ID: 1014296488

View in Genome Browser
Species Human (GRCh38)
Location 6:119624960-119624982
Sequence ACGAGGACTTTGATAGATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014296488_1014296489 -10 Left 1014296488 6:119624960-119624982 CCTGTATCTATCAAAGTCCTCGT No data
Right 1014296489 6:119624973-119624995 AAGTCCTCGTCTGTAGAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014296488 Original CRISPR ACGAGGACTTTGATAGATAC AGG (reversed) Intergenic
No off target data available for this crispr