ID: 1014296816

View in Genome Browser
Species Human (GRCh38)
Location 6:119628506-119628528
Sequence CAGGCTAATTACTCTTAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014296816_1014296821 6 Left 1014296816 6:119628506-119628528 CCTTTCTAAGAGTAATTAGCCTG No data
Right 1014296821 6:119628535-119628557 TGTTCCTAAGCTCAAACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014296816 Original CRISPR CAGGCTAATTACTCTTAGAA AGG (reversed) Intergenic
No off target data available for this crispr