ID: 1014299023

View in Genome Browser
Species Human (GRCh38)
Location 6:119657230-119657252
Sequence TTTGTGAGTTATGATTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014299023_1014299025 13 Left 1014299023 6:119657230-119657252 CCAACAAAATCATAACTCACAAA No data
Right 1014299025 6:119657266-119657288 AAAATTAGCTTAAAAATATAGGG No data
1014299023_1014299024 12 Left 1014299023 6:119657230-119657252 CCAACAAAATCATAACTCACAAA No data
Right 1014299024 6:119657265-119657287 TAAAATTAGCTTAAAAATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014299023 Original CRISPR TTTGTGAGTTATGATTTTGT TGG (reversed) Intergenic
No off target data available for this crispr