ID: 1014303976

View in Genome Browser
Species Human (GRCh38)
Location 6:119717090-119717112
Sequence CTGGGTCAGTGGAGAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014303969_1014303976 13 Left 1014303969 6:119717054-119717076 CCTTTCAGGCATACACAGAACAC No data
Right 1014303976 6:119717090-119717112 CTGGGTCAGTGGAGAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014303976 Original CRISPR CTGGGTCAGTGGAGAGTGGA GGG Intergenic
No off target data available for this crispr