ID: 1014308513

View in Genome Browser
Species Human (GRCh38)
Location 6:119770619-119770641
Sequence GGAAAGATAATGAGAGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014308513_1014308516 2 Left 1014308513 6:119770619-119770641 CCTGGTTCTCTCATTATCTTTCC No data
Right 1014308516 6:119770644-119770666 TACTTTAGCATAGGCCCCAGTGG No data
1014308513_1014308514 -7 Left 1014308513 6:119770619-119770641 CCTGGTTCTCTCATTATCTTTCC No data
Right 1014308514 6:119770635-119770657 TCTTTCCAATACTTTAGCATAGG No data
1014308513_1014308517 13 Left 1014308513 6:119770619-119770641 CCTGGTTCTCTCATTATCTTTCC No data
Right 1014308517 6:119770655-119770677 AGGCCCCAGTGGACTATCAGAGG No data
1014308513_1014308518 14 Left 1014308513 6:119770619-119770641 CCTGGTTCTCTCATTATCTTTCC No data
Right 1014308518 6:119770656-119770678 GGCCCCAGTGGACTATCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014308513 Original CRISPR GGAAAGATAATGAGAGAACC AGG (reversed) Intergenic
No off target data available for this crispr