ID: 1014308518

View in Genome Browser
Species Human (GRCh38)
Location 6:119770656-119770678
Sequence GGCCCCAGTGGACTATCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014308513_1014308518 14 Left 1014308513 6:119770619-119770641 CCTGGTTCTCTCATTATCTTTCC No data
Right 1014308518 6:119770656-119770678 GGCCCCAGTGGACTATCAGAGGG No data
1014308515_1014308518 -7 Left 1014308515 6:119770640-119770662 CCAATACTTTAGCATAGGCCCCA No data
Right 1014308518 6:119770656-119770678 GGCCCCAGTGGACTATCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014308518 Original CRISPR GGCCCCAGTGGACTATCAGA GGG Intergenic
No off target data available for this crispr