ID: 1014311290

View in Genome Browser
Species Human (GRCh38)
Location 6:119805385-119805407
Sequence TGTTAGGCCCAGAAATGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014311290_1014311295 15 Left 1014311290 6:119805385-119805407 CCCATCCATTTCTGGGCCTAACA No data
Right 1014311295 6:119805423-119805445 CAATCATACCCCATCACCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014311290 Original CRISPR TGTTAGGCCCAGAAATGGAT GGG (reversed) Intergenic
No off target data available for this crispr