ID: 1014313116

View in Genome Browser
Species Human (GRCh38)
Location 6:119830252-119830274
Sequence GCTCTCAGGAAGCCACATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014313116_1014313119 8 Left 1014313116 6:119830252-119830274 CCAGGATGTGGCTTCCTGAGAGC No data
Right 1014313119 6:119830283-119830305 AGTGATTCTTTTTTCTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014313116 Original CRISPR GCTCTCAGGAAGCCACATCC TGG (reversed) Intergenic
No off target data available for this crispr