ID: 1014330380

View in Genome Browser
Species Human (GRCh38)
Location 6:120056246-120056268
Sequence CAGTCTACCCAAAGGCTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014330372_1014330380 15 Left 1014330372 6:120056208-120056230 CCCTCAACCCCCATCAGGTAAGT No data
Right 1014330380 6:120056246-120056268 CAGTCTACCCAAAGGCTAGTTGG No data
1014330377_1014330380 5 Left 1014330377 6:120056218-120056240 CCATCAGGTAAGTGCCTTCAGTC No data
Right 1014330380 6:120056246-120056268 CAGTCTACCCAAAGGCTAGTTGG No data
1014330375_1014330380 7 Left 1014330375 6:120056216-120056238 CCCCATCAGGTAAGTGCCTTCAG No data
Right 1014330380 6:120056246-120056268 CAGTCTACCCAAAGGCTAGTTGG No data
1014330364_1014330380 27 Left 1014330364 6:120056196-120056218 CCCCGCCCCCATCCCTCAACCCC No data
Right 1014330380 6:120056246-120056268 CAGTCTACCCAAAGGCTAGTTGG No data
1014330378_1014330380 -9 Left 1014330378 6:120056232-120056254 CCTTCAGTCATCATCAGTCTACC No data
Right 1014330380 6:120056246-120056268 CAGTCTACCCAAAGGCTAGTTGG No data
1014330369_1014330380 20 Left 1014330369 6:120056203-120056225 CCCATCCCTCAACCCCCATCAGG No data
Right 1014330380 6:120056246-120056268 CAGTCTACCCAAAGGCTAGTTGG No data
1014330367_1014330380 22 Left 1014330367 6:120056201-120056223 CCCCCATCCCTCAACCCCCATCA No data
Right 1014330380 6:120056246-120056268 CAGTCTACCCAAAGGCTAGTTGG No data
1014330365_1014330380 26 Left 1014330365 6:120056197-120056219 CCCGCCCCCATCCCTCAACCCCC No data
Right 1014330380 6:120056246-120056268 CAGTCTACCCAAAGGCTAGTTGG No data
1014330371_1014330380 19 Left 1014330371 6:120056204-120056226 CCATCCCTCAACCCCCATCAGGT No data
Right 1014330380 6:120056246-120056268 CAGTCTACCCAAAGGCTAGTTGG No data
1014330366_1014330380 25 Left 1014330366 6:120056198-120056220 CCGCCCCCATCCCTCAACCCCCA No data
Right 1014330380 6:120056246-120056268 CAGTCTACCCAAAGGCTAGTTGG No data
1014330368_1014330380 21 Left 1014330368 6:120056202-120056224 CCCCATCCCTCAACCCCCATCAG No data
Right 1014330380 6:120056246-120056268 CAGTCTACCCAAAGGCTAGTTGG No data
1014330374_1014330380 8 Left 1014330374 6:120056215-120056237 CCCCCATCAGGTAAGTGCCTTCA No data
Right 1014330380 6:120056246-120056268 CAGTCTACCCAAAGGCTAGTTGG No data
1014330376_1014330380 6 Left 1014330376 6:120056217-120056239 CCCATCAGGTAAGTGCCTTCAGT No data
Right 1014330380 6:120056246-120056268 CAGTCTACCCAAAGGCTAGTTGG No data
1014330373_1014330380 14 Left 1014330373 6:120056209-120056231 CCTCAACCCCCATCAGGTAAGTG No data
Right 1014330380 6:120056246-120056268 CAGTCTACCCAAAGGCTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014330380 Original CRISPR CAGTCTACCCAAAGGCTAGT TGG Intergenic
No off target data available for this crispr