ID: 1014330826

View in Genome Browser
Species Human (GRCh38)
Location 6:120061412-120061434
Sequence CTGTATTAGCAGCATGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014330826_1014330829 18 Left 1014330826 6:120061412-120061434 CCATTCTCATGCTGCTAATACAG No data
Right 1014330829 6:120061453-120061475 AATTTATAAAGGAAGTTTAATGG No data
1014330826_1014330828 7 Left 1014330826 6:120061412-120061434 CCATTCTCATGCTGCTAATACAG No data
Right 1014330828 6:120061442-120061464 TGAGATTGGATAATTTATAAAGG No data
1014330826_1014330827 -7 Left 1014330826 6:120061412-120061434 CCATTCTCATGCTGCTAATACAG No data
Right 1014330827 6:120061428-120061450 AATACAGACATACATGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014330826 Original CRISPR CTGTATTAGCAGCATGAGAA TGG (reversed) Intergenic
No off target data available for this crispr