ID: 1014331606

View in Genome Browser
Species Human (GRCh38)
Location 6:120073934-120073956
Sequence GCTCATGTATAAGCAGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014331606_1014331610 28 Left 1014331606 6:120073934-120073956 CCTATTTCTGCTTATACATGAGC No data
Right 1014331610 6:120073985-120074007 TTATTTCTAATGGCAATGTTAGG No data
1014331606_1014331608 18 Left 1014331606 6:120073934-120073956 CCTATTTCTGCTTATACATGAGC No data
Right 1014331608 6:120073975-120073997 ATAACTCCAATTATTTCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014331606 Original CRISPR GCTCATGTATAAGCAGAAAT AGG (reversed) Intergenic
No off target data available for this crispr