ID: 1014341554

View in Genome Browser
Species Human (GRCh38)
Location 6:120214044-120214066
Sequence GGCAAATGTTTTTGGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014341554_1014341557 29 Left 1014341554 6:120214044-120214066 CCAGCACACCAAAAACATTTGCC No data
Right 1014341557 6:120214096-120214118 CTCCTTTTAACAAAAACATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014341554 Original CRISPR GGCAAATGTTTTTGGTGTGC TGG (reversed) Intergenic
No off target data available for this crispr