ID: 1014344130

View in Genome Browser
Species Human (GRCh38)
Location 6:120246008-120246030
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014344130_1014344137 16 Left 1014344130 6:120246008-120246030 CCCATCAAAACCAGGATCCCTGT No data
Right 1014344137 6:120246047-120246069 AAGGTGATCTTCATCACAAATGG No data
1014344130_1014344135 -3 Left 1014344130 6:120246008-120246030 CCCATCAAAACCAGGATCCCTGT No data
Right 1014344135 6:120246028-120246050 TGTTTCTCCAACTCTTCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014344130 Original CRISPR ACAGGGATCCTGGTTTTGAT GGG (reversed) Intergenic
No off target data available for this crispr