ID: 1014354792

View in Genome Browser
Species Human (GRCh38)
Location 6:120393456-120393478
Sequence GTGGGTAAATCACCTGATGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014354789_1014354792 -2 Left 1014354789 6:120393435-120393457 CCAGCACTTTGGGAGGGCGAGGT 0: 224
1: 37071
2: 180762
3: 258239
4: 173775
Right 1014354792 6:120393456-120393478 GTGGGTAAATCACCTGATGTCGG No data
1014354785_1014354792 7 Left 1014354785 6:120393426-120393448 CCTATAATTCCAGCACTTTGGGA 0: 1379
1: 40795
2: 331669
3: 246123
4: 133063
Right 1014354792 6:120393456-120393478 GTGGGTAAATCACCTGATGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014354792 Original CRISPR GTGGGTAAATCACCTGATGT CGG Intergenic
No off target data available for this crispr