ID: 1014358982

View in Genome Browser
Species Human (GRCh38)
Location 6:120451727-120451749
Sequence CTGAGTGTGTTCTGATTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014358982_1014358984 1 Left 1014358982 6:120451727-120451749 CCAGTGAATCAGAACACACTCAG No data
Right 1014358984 6:120451751-120451773 GTCAACAAGTTATATAAAAAGGG No data
1014358982_1014358985 28 Left 1014358982 6:120451727-120451749 CCAGTGAATCAGAACACACTCAG No data
Right 1014358985 6:120451778-120451800 GTGTTTACAGAGATGTAGCAAGG No data
1014358982_1014358983 0 Left 1014358982 6:120451727-120451749 CCAGTGAATCAGAACACACTCAG No data
Right 1014358983 6:120451750-120451772 AGTCAACAAGTTATATAAAAAGG No data
1014358982_1014358986 29 Left 1014358982 6:120451727-120451749 CCAGTGAATCAGAACACACTCAG No data
Right 1014358986 6:120451779-120451801 TGTTTACAGAGATGTAGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014358982 Original CRISPR CTGAGTGTGTTCTGATTCAC TGG (reversed) Intergenic
No off target data available for this crispr