ID: 1014358985

View in Genome Browser
Species Human (GRCh38)
Location 6:120451778-120451800
Sequence GTGTTTACAGAGATGTAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014358982_1014358985 28 Left 1014358982 6:120451727-120451749 CCAGTGAATCAGAACACACTCAG No data
Right 1014358985 6:120451778-120451800 GTGTTTACAGAGATGTAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014358985 Original CRISPR GTGTTTACAGAGATGTAGCA AGG Intergenic
No off target data available for this crispr