ID: 1014363396

View in Genome Browser
Species Human (GRCh38)
Location 6:120508344-120508366
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 727
Summary {0: 4, 1: 171, 2: 199, 3: 148, 4: 205}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014363396_1014363399 -10 Left 1014363396 6:120508344-120508366 CCAGTAACAGGCCAAGAGCTCTC 0: 4
1: 171
2: 199
3: 148
4: 205
Right 1014363399 6:120508357-120508379 AAGAGCTCTCTCTCAAAAGGAGG No data
1014363396_1014363403 16 Left 1014363396 6:120508344-120508366 CCAGTAACAGGCCAAGAGCTCTC 0: 4
1: 171
2: 199
3: 148
4: 205
Right 1014363403 6:120508383-120508405 GTTATCTGAAAAAGATGGCAGGG No data
1014363396_1014363402 15 Left 1014363396 6:120508344-120508366 CCAGTAACAGGCCAAGAGCTCTC 0: 4
1: 171
2: 199
3: 148
4: 205
Right 1014363402 6:120508382-120508404 AGTTATCTGAAAAAGATGGCAGG No data
1014363396_1014363401 11 Left 1014363396 6:120508344-120508366 CCAGTAACAGGCCAAGAGCTCTC 0: 4
1: 171
2: 199
3: 148
4: 205
Right 1014363401 6:120508378-120508400 GGGTAGTTATCTGAAAAAGATGG No data
1014363396_1014363400 -9 Left 1014363396 6:120508344-120508366 CCAGTAACAGGCCAAGAGCTCTC 0: 4
1: 171
2: 199
3: 148
4: 205
Right 1014363400 6:120508358-120508380 AGAGCTCTCTCTCAAAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014363396 Original CRISPR GAGAGCTCTTGGCCTGTTAC TGG (reversed) Intergenic
900434961 1:2625612-2625634 GACAGCTCTTGGCCCGTTACTGG + Intronic
900634116 1:3653247-3653269 GAGGGCTCCTGGCCTGTCTCCGG + Intronic
901444630 1:9300560-9300582 GACAGCTCTTGGCCTAATACTGG + Intronic
901904048 1:12392648-12392670 GACAGCTCTTGGCCTGTTACTGG - Intronic
902692107 1:18116482-18116504 GAGAGCTTTTGGCATGTAACTGG + Intronic
903123408 1:21231629-21231651 TAGAGTTCTTGGCCAGGTACGGG - Intronic
904179491 1:28655935-28655957 GACAGCTCTTGGCCTATTACTGG - Intergenic
904335935 1:29798022-29798044 GACAGCTCTTGGCCTATTACTGG + Intergenic
904373409 1:30065237-30065259 GAGAGCTCTTGGCTTTCTCCGGG - Intergenic
904662196 1:32093730-32093752 GAAAGCTCCAGGCGTGTTACAGG - Intronic
905207943 1:36353549-36353571 GAGAGCTGGTGGCATTTTACAGG + Intronic
905257543 1:36694587-36694609 GAGAGCACCTGGCCTGAGACAGG - Intergenic
905465227 1:38148135-38148157 AACAGCTCTTAGCCTGTTACTGG + Intergenic
906050491 1:42867450-42867472 GACAGCTCTTGGCCTGTTACTGG + Intergenic
907780344 1:57560870-57560892 GTCAGCTCTTGGCCTGTTACTGG + Intronic
908052313 1:60246749-60246771 GACAGCTTTCGGCCTGTTGCTGG + Intergenic
909172605 1:72315430-72315452 GATGGCTCTTGTCCTCTTACTGG - Intergenic
909576923 1:77185894-77185916 GACAGCTCTTGGCCTGTTACTGG + Intronic
909810956 1:79931373-79931395 GACAGCTCTTGGCCTGTTACTGG + Intergenic
910370637 1:86512164-86512186 GACAGCTCTTGGCCTGTTACTGG + Intergenic
910561903 1:88600017-88600039 GACAGCTCTTGGCCTGTTATTGG + Intergenic
910588218 1:88901762-88901784 GACAGCTCTTGTCTTGTTACTGG + Intergenic
910630224 1:89346288-89346310 GGCAGCTCTTGGCCTGTTACTGG + Intergenic
910638988 1:89439938-89439960 GACAACTCTTGGCCTGTTACTGG - Intergenic
910790324 1:91043756-91043778 GACAGCTGTTGGCCTGTTACTGG + Intergenic
910831095 1:91463388-91463410 GATAGCTCTTGGCCTGTTATTGG - Intergenic
910948217 1:92616724-92616746 GACAGCTGTTGGCCTGTTACTGG + Intronic
911109095 1:94164169-94164191 GACAACTCTTGGCCTGTTACTGG - Intronic
911257322 1:95647328-95647350 GGCAGCTCTTGGCCTGTTACTGG - Intergenic
911345228 1:96688822-96688844 GAAAGCTGTTGGCCTGTAAATGG - Intergenic
911738395 1:101361883-101361905 CACAGCTCTTGGCCTGTTACTGG - Intergenic
911981897 1:104579226-104579248 GAAAACTCTTGGCCTGTTATTGG - Intergenic
912050675 1:105524911-105524933 GATAACTCTTGGCCTATTACTGG - Intergenic
912067025 1:105756983-105757005 GACAGCTCTTGGCCTGTTACTGG + Intergenic
912129909 1:106588014-106588036 GACAACTCTTGGCCTGTTACTGG - Intergenic
912212255 1:107568930-107568952 GACAGCTCTTGGATTGCTACTGG + Intergenic
912252026 1:108021352-108021374 GACAGCTCTTGGGTTGTTACTGG - Intergenic
912733320 1:112128793-112128815 GACAGCTCTTGGCCTGTTACTGG - Intergenic
912943810 1:114068168-114068190 GACAGCTTTTAGCCTGTTACTGG - Intergenic
913039444 1:115008359-115008381 GACAGCTCTTGTCCTGTTACTGG - Intergenic
913576081 1:120176523-120176545 GAAAGCTCTTGCGCTGTTTCCGG - Intergenic
915667667 1:157459607-157459629 GACAGCTCTTGGTCTGTTGCGGG - Intergenic
916017355 1:160761956-160761978 AAGAGCACTTGGCCTATTACTGG - Intergenic
916106327 1:161435291-161435313 GACAGCTCTTGGCCTGTTACTGG - Intergenic
916285319 1:163099564-163099586 GACAGCTCTTGGCCTGTTACTGG + Intergenic
916365965 1:164028051-164028073 AACAGCTCTTGGTCTGCTACTGG - Intergenic
916369829 1:164079832-164079854 AATAGCTTTTGGCCTGTTACTGG + Intergenic
916786269 1:168089420-168089442 GAGAGGTCATGGCCTGGTCCCGG + Intronic
917217211 1:172690877-172690899 GGCAGCTCTTGGTCTGTTACTGG - Intergenic
917276498 1:173337230-173337252 AACAACTCTTGGCCTGCTACTGG + Intergenic
917462710 1:175246219-175246241 GACAGCTCTTGGCCTGTTACTGG + Intergenic
918755711 1:188337773-188337795 GATGGCTCTTGGCCCGTTACTGG - Intergenic
918774495 1:188610783-188610805 GACATCTCTTTGCCTGTTACTGG + Intergenic
918815080 1:189171264-189171286 ACCAGCTCTTGGTCTGTTACTGG + Intergenic
918918229 1:190671843-190671865 GACAGCTCTTGGCCTGTTAATGG - Intergenic
918958248 1:191237985-191238007 GACAGCTCTTGGCCTGTTACTGG + Intergenic
919241775 1:194924240-194924262 GACAGCTATTGGCCTGTTAATGG + Intergenic
919317976 1:195999398-195999420 GATAGCTTTTGGCCTGTTACTGG + Intergenic
920197433 1:204238402-204238424 GACACCTGTTGGTCTGTTACTGG + Intronic
921619822 1:217313173-217313195 GACAGCTCTTGGTCTGCCACTGG + Intergenic
922603869 1:226876920-226876942 GAGAGCTCTTGGGCTGAAAAAGG - Intronic
923253567 1:232199401-232199423 GACAGCTCTTGGCCTGTTACTGG - Intergenic
924182506 1:241453205-241453227 GACAGTTCTTGGCCTGCTACTGG - Intergenic
924477396 1:244394165-244394187 GACAACTCTTGGCCTACTACTGG - Intergenic
924840774 1:247707796-247707818 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1062999126 10:1897934-1897956 GTGAGCTCTTGCCCTGTCCCAGG + Intergenic
1064517640 10:16168220-16168242 GACAGCTCTTGCCACGTTACCGG - Intergenic
1064545686 10:16448099-16448121 GACAGCTCTTGGCCAGTTACTGG - Intronic
1065005328 10:21374200-21374222 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1066167025 10:32799194-32799216 GTCAGCTCTTGGCCTGTTACTGG - Intronic
1066169429 10:32826354-32826376 GACACCTCTTGTCCTATTACTGG + Intronic
1067125551 10:43512508-43512530 GACAGTTCTTGGCCTATTACTGG - Intergenic
1067518968 10:46980521-46980543 AACAGCTTTTGGCCTGCTACTGG + Intronic
1067643278 10:48071313-48071335 AACAGCTTTTGGCCTGCTACTGG - Intergenic
1068007671 10:51409534-51409556 GACAGCTCTTGGCCTGTCACTGG - Intronic
1068447212 10:57138629-57138651 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1068837214 10:61568342-61568364 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1069145765 10:64890476-64890498 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1069192303 10:65506334-65506356 GACAGCCCTTGGCCTGTTACTGG - Intergenic
1069790829 10:71019547-71019569 GACAGCCCTTGGCCTGTTACTGG - Intergenic
1070364534 10:75723511-75723533 GGGGGCTCTTGGCCTCTGACAGG + Intronic
1071267084 10:83973966-83973988 GACAGCCCTTGGCCTGTTACTGG - Intergenic
1071673925 10:87637393-87637415 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1071697049 10:87887690-87887712 TAGAGCTCTGGGCCTGTGATGGG - Intronic
1071937690 10:90549312-90549334 GACAGCTCTTGGCCTGTTCCTGG + Intergenic
1071942783 10:90607742-90607764 GACCGCCCTTGGCCTGTTACTGG - Intergenic
1071947084 10:90657695-90657717 GATAGCTCTTGGTCTGCTACTGG - Intergenic
1071950796 10:90700901-90700923 GACAGCTTTTGGCCTGGTGCTGG - Intergenic
1072209256 10:93231642-93231664 GACAGATCTTGGCTTGTTACTGG - Intergenic
1073557351 10:104465936-104465958 GACAGCTCTTGGTCTGTTACTGG + Intergenic
1073656679 10:105424448-105424470 TACAGCTCTTGGCCTGTTACTGG - Intergenic
1073830503 10:107377973-107377995 GACAGTTCTTGGCCTATTACTGG - Intergenic
1073918474 10:108432279-108432301 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1073957680 10:108891617-108891639 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1073995871 10:109314681-109314703 GATAGCTCTTGGCTTATTACTGG - Intergenic
1075284344 10:121170356-121170378 GAGATTTCTTGGGCTGTAACAGG + Intergenic
1075606791 10:123817435-123817457 GACAGCACTTGGCCTGTTACTGG + Intronic
1076772627 10:132674803-132674825 GACAGCTCTTGGCCTGTTACTGG - Intronic
1076927414 10:133499190-133499212 GACAGCTCTTAGCCTGTTACTGG - Intergenic
1078605177 11:12768914-12768936 GAGGGCACCTGGCCTGTTGCTGG + Intronic
1080020138 11:27551630-27551652 GACAGCTCTGGGCCTGCTACTGG - Intergenic
1080076595 11:28157531-28157553 GACAGCTCTTGGCCTGTTACTGG + Intronic
1080976682 11:37350608-37350630 GACAGCTTTTGGCTTGTTACTGG + Intergenic
1081065459 11:38534866-38534888 GGCAGCTCTTGGCTTGTTATTGG - Intergenic
1081072778 11:38631131-38631153 GACATTTCTTGGCCTGTTACTGG + Intergenic
1081110479 11:39128429-39128451 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1081578466 11:44334594-44334616 GCGAGTCCTTGGCCTGTTTCGGG - Intergenic
1081609063 11:44547888-44547910 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1082671701 11:56043052-56043074 GATAGCTCTTTGCCTGCTACTGG + Intergenic
1082999663 11:59279889-59279911 GAGAGTTCTTGGCCTGTTACTGG + Intergenic
1083093146 11:60221137-60221159 AAGAGCTCTTGCCCTGTTACTGG + Intronic
1084506177 11:69569894-69569916 GAGAGCTGTTGGCCTGTGGATGG - Intergenic
1085079268 11:73620732-73620754 AACAGCTCTTGGCCTGCTACAGG + Intergenic
1085470953 11:76757554-76757576 AAGAGCTCATGGCCTGGGACAGG - Intergenic
1085684622 11:78610427-78610449 AACAGCTCTTGGCCTGATACTGG + Intergenic
1085685964 11:78622200-78622222 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1085747572 11:79128250-79128272 GACAGCTCTTGGCCTGTTACTGG + Intronic
1086278614 11:85160462-85160484 AACAGCTCTTGGCCTGTTATTGG + Intronic
1086834117 11:91600403-91600425 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1087021603 11:93608717-93608739 AATAGCTCTTGGCCTGCTACTGG - Intergenic
1088097206 11:106115168-106115190 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1088191659 11:107234480-107234502 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1088407610 11:109498652-109498674 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1088836657 11:113583399-113583421 GACAGCTCTTGGCCTGTCACTGG + Intergenic
1089903607 11:122013619-122013641 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1090209491 11:124908040-124908062 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1090221614 11:125031575-125031597 GACAGCTCTTAGCCTGTTACTGG - Intronic
1091103473 11:132897270-132897292 GAGAGCTCTTGGCCAGCTACTGG + Intronic
1091727670 12:2857000-2857022 GAGTGATCTTTGCCGGTTACTGG + Intronic
1092093285 12:5821661-5821683 GACAGCTCTTGGCCTGTTACAGG + Intronic
1092535139 12:9379888-9379910 TACAGCTCATGGCCTGGTACAGG + Intergenic
1092731314 12:11537867-11537889 GTGAGCTCTGGGCATGTGACAGG - Intergenic
1093031869 12:14295939-14295961 GACAGCTGTTGGCCTGTTACTGG - Intergenic
1093036338 12:14335694-14335716 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1093049669 12:14490952-14490974 GACAGCTCTTGGCCTGTTAAAGG - Intronic
1093645730 12:21583681-21583703 GAAAGCTCTTGGCCTGTTACTGG + Intronic
1094102532 12:26779273-26779295 GACAGCTCTTGGTCTGGTACTGG + Intronic
1094493175 12:30973961-30973983 GAGAGCTCTTGGGTTGTACCTGG + Intronic
1095121505 12:38424833-38424855 GGCAACTCTTGGCCTGTGACAGG - Intergenic
1095603855 12:44044345-44044367 GACAGCTCTTGGCCTGTTTCTGG + Intronic
1095844394 12:46729957-46729979 AACAGCTCTTGGCCTGTTAATGG - Intergenic
1095856239 12:46863664-46863686 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1095881729 12:47144319-47144341 TAGAGCTCTGGTCCTGTAACAGG + Intronic
1096288713 12:50322971-50322993 GACAGCTCTTGGCCTGCTACTGG + Intergenic
1096457465 12:51799426-51799448 GACGGCTCTTGGCCTGTTACTGG - Intronic
1096734789 12:53644211-53644233 AGTAGCTCTTGGCCTGCTACTGG + Intronic
1097077001 12:56402452-56402474 GACAGCTCTTGACCTGTTACTGG + Intergenic
1097279526 12:57836074-57836096 GAGGGCTCCTGGTCTGTTGCTGG - Intronic
1097437837 12:59572243-59572265 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1097564647 12:61252418-61252440 GACAGCTCTTGACCTGTTACTGG - Intergenic
1097821340 12:64131853-64131875 GACAGCTCTTGGCCTGTTACTGG - Intronic
1097843356 12:64342750-64342772 AACAGCTCTTGGCCTGTTACTGG - Intronic
1098239852 12:68456033-68456055 TAGAGCTTTTATCCTGTTACAGG - Intergenic
1098414362 12:70215919-70215941 GAGAGCTCATGACCTCTTAAAGG + Intergenic
1098627616 12:72691809-72691831 GAGAGCTCTGGCCCTGTGGCTGG + Intergenic
1098673042 12:73254255-73254277 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1098716091 12:73829826-73829848 GACAGTTCTTGGCCCGTTACTGG + Intergenic
1098731052 12:74037359-74037381 GACAGCTGTTGGCCTGTTACTGG + Intergenic
1098733294 12:74065642-74065664 GAAAGCTCTTGGCTGGTTATTGG + Intergenic
1098807198 12:75034984-75035006 AACAGCTCTTGGACTGGTACTGG + Intergenic
1098831904 12:75374014-75374036 GAAAGCTCTTGGCCTGTAAGTGG - Intronic
1099365925 12:81765395-81765417 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1099379381 12:81936529-81936551 GGCAGCTCTTGGCCTGTTACTGG - Intergenic
1099508562 12:83507198-83507220 GACAGCTCTTGGCCTGCTACTGG + Intergenic
1099578077 12:84405402-84405424 GGCAGCTTTTGGCCTGTTACTGG + Intergenic
1099689781 12:85938048-85938070 GACAGCTCTTTGTCTGTTACTGG + Intergenic
1100083304 12:90878223-90878245 GACAGCTCTTTGCCTGTTACTGG + Intergenic
1100241151 12:92711597-92711619 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1100685929 12:96985910-96985932 GAGACCTCTTGGCCTCTTTAAGG + Intergenic
1101264132 12:103066133-103066155 GACAGCTCTTGGCCAATTACTGG + Intergenic
1101534667 12:105606093-105606115 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1101543072 12:105682647-105682669 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1101697456 12:107139819-107139841 AAAAGCTCTTGGCCTGCTACTGG - Intergenic
1103396528 12:120611458-120611480 GACAGCTCTTGACCTGTTACTGG + Intergenic
1105740110 13:23315187-23315209 GACAACTCTTGGCCTGTTACTGG + Intronic
1107505170 13:41026628-41026650 GACAGCTCTTGACCTGCTACTGG + Intronic
1107983575 13:45755961-45755983 GACAGCTCTTGGCCTATTACTGG - Intergenic
1108302433 13:49091974-49091996 GACAGCTCTTGGCCCGTTACTGG - Intronic
1108451611 13:50572254-50572276 GAGAGCACTTGCTCTGTTTCAGG - Intronic
1109293225 13:60500129-60500151 GACGGCTCTTGGCCTGTTACTGG + Intronic
1109519023 13:63484812-63484834 GACAGCTCTTGGCTTGTTACTGG + Intergenic
1109583049 13:64366178-64366200 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1109712680 13:66180811-66180833 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1109951023 13:69502194-69502216 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1110377173 13:74806480-74806502 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1110834134 13:80064618-80064640 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1111057798 13:82973016-82973038 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1111317503 13:86581812-86581834 GAGAGCTCTTGGCCTGTTACTGG + Intergenic
1111432252 13:88159623-88159645 GACAGATCTTGGCCTGCTACTGG - Intergenic
1112231126 13:97590153-97590175 GATAGCTCTTGGTTTGTTACTGG - Intergenic
1112249926 13:97770267-97770289 GACAGCTCTTGGGCTGTTACTGG - Intergenic
1112308828 13:98300080-98300102 GTTGGCTCTTGGCCTATTACTGG - Intronic
1113319704 13:109221652-109221674 GACAGCTCTTGACCTATTACTGG - Intergenic
1114205871 14:20570780-20570802 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1114758257 14:25283865-25283887 GATAGCTCTTCACCTGTTACTGG - Intergenic
1115059717 14:29173905-29173927 GACAGCTCTTGGCTTGTAACTGG + Intergenic
1115070785 14:29319635-29319657 AACAGCTCTTAGCCTGCTACTGG + Intergenic
1115130694 14:30049271-30049293 GACAGCTCTTGGCCTGTCACTGG + Intronic
1115143400 14:30199398-30199420 GGCAACTCTTGGCCTGCTACTGG + Intergenic
1116058909 14:39896949-39896971 GACAGCTCTTGGCCTGTTGCTGG + Intergenic
1116068095 14:40009182-40009204 AACAGCTCTTGGCCTGTTACTGG + Intergenic
1116158377 14:41236654-41236676 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1116308043 14:43283436-43283458 GACAGCTCTTGGCCTGCTACTGG - Intergenic
1117216844 14:53560186-53560208 GACACCTCTTGGCCTGTTACTGG + Intergenic
1117634134 14:57724384-57724406 GACAGCTGTTGGCCTGTTACTGG + Intronic
1118122433 14:62860159-62860181 GACAGCTCTTAGCCTGTTACTGG - Intronic
1118385501 14:65252534-65252556 GACAGCTCTTGGTCTGCTACTGG - Intergenic
1118501835 14:66369400-66369422 GATAGCTCTTGGCCTGCTACTGG + Intergenic
1118880773 14:69824007-69824029 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1119059696 14:71462179-71462201 GACAGCTCTTTGTCTGTTACTGG - Intronic
1119107563 14:71938828-71938850 GACAGCTCTTGGCCTATTACTGG - Intronic
1120082024 14:80227519-80227541 GACAGCTCTTTGCCTGTTCCTGG - Intronic
1120169407 14:81233997-81234019 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1120231422 14:81845240-81845262 GACAGCTGTTGGCCTGTTACTGG - Intergenic
1120555991 14:85930427-85930449 AGCAGCTCTTGGCCTGTTACTGG - Intergenic
1120973704 14:90230837-90230859 AGAAGCTCTTGGCCTGTTACTGG + Intergenic
1121902414 14:97706156-97706178 GAGAGCTCTGGGCTGGTGACAGG - Intergenic
1123776807 15:23588711-23588733 GAGGGCTCTTGGGCTGATCCTGG - Intronic
1123908497 15:24943643-24943665 AACAGCTGTTGGCCTGCTACTGG - Intronic
1125879697 15:43183461-43183483 GAGAGGTCTTGGCCTCTTTAAGG - Intronic
1126283611 15:46986288-46986310 AACAACTCTTGGCCTGTTATTGG + Intergenic
1127217296 15:56836963-56836985 GCGAGCACTTTGCCTGCTACTGG + Intronic
1127356917 15:58209200-58209222 GACAGCTCTTGGCCTGTTATTGG + Intronic
1128230724 15:66033295-66033317 TAGAGCTCGGGGCCTGTTATGGG - Intronic
1129300843 15:74624579-74624601 GTGAGCTCTTGGACTGGCACTGG + Intronic
1131724011 15:95202806-95202828 GACAGCTCTTGGCCTGTTACCGG + Intergenic
1132305739 15:100810856-100810878 AACAGCTCTTGGCCTGCTACTGG - Intergenic
1135626004 16:23995507-23995529 GACAGCTCTTGGCCTGCTACCGG + Intronic
1136711370 16:32240008-32240030 GCCAGATCTTCGCCTGTTACAGG - Intergenic
1136756539 16:32689397-32689419 GCCAGATCTTCGCCTGTTACAGG + Intergenic
1136811572 16:33180976-33180998 GCCAGATCTTCGCCTGTTACAGG - Intergenic
1136818048 16:33291056-33291078 GCCAGATCTTCGCCTGTTACAGG - Intronic
1136824612 16:33347585-33347607 GCCAGATCTTCGCCTGTTACAGG - Intergenic
1136829678 16:33446356-33446378 GCCAGATCTTCGCCTGTTACAGG - Intergenic
1137031325 16:35526930-35526952 GCCAGATCTTCGCCTGTTACAGG + Intergenic
1141363586 16:83420810-83420832 GAGAGCTCCTGGCAAGTCACTGG + Intronic
1141559542 16:84858027-84858049 GACAGCTCTTGGCCTGTTACTGG - Intronic
1142022293 16:87791446-87791468 AAGAGCTCTTGGCCTGGGCCAGG - Intergenic
1202990150 16_KI270728v1_random:3945-3967 GCCAGATCTTCGCCTGTTACAGG - Intergenic
1203058685 16_KI270728v1_random:949751-949773 GCCAGATCTTCGCCTGTTACAGG + Intergenic
1142475527 17:186724-186746 CACAGCTCGGGGCCTGTTACAGG - Intergenic
1145322991 17:21777433-21777455 GAGAGCTCTGGGGCTCTTGCAGG + Intergenic
1145785138 17:27588621-27588643 GCGAGCTCTTTGCCTCTGACGGG + Intronic
1146237984 17:31185959-31185981 TACAGCTCTTGACCTGTTACTGG + Intronic
1146476746 17:33168999-33169021 TAGAGCTCTGGGCCTGTGATGGG - Intronic
1146836356 17:36114011-36114033 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1146850934 17:36221051-36221073 GACAGCTCTTAGCCTGTTACTGG + Intronic
1148244427 17:46021214-46021236 GAGAGCTCTCGGCCAGCTACGGG - Intronic
1150950375 17:69797508-69797530 GAAAGATCTTGGCCTGTTCGAGG + Intergenic
1151067297 17:71165907-71165929 AAGAGCTCTTAGCTAGTTACTGG + Intergenic
1153089710 18:1330169-1330191 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1153217693 18:2835595-2835617 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1154506173 18:15042897-15042919 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1155940708 18:31799605-31799627 GACAGCTCTTGGTCTGTTACTGG + Intergenic
1156303861 18:35858701-35858723 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1156582551 18:38394471-38394493 GACAGCTCTTAGCCTATTACTGG + Intergenic
1156990302 18:43400768-43400790 GATGGCTCTTGGGCTATTACTGG - Intergenic
1156998580 18:43497736-43497758 GATAGCTTTTGGCCTCTTACTGG + Intergenic
1157341203 18:46780034-46780056 GACAACTCTTGGCCTGTTACTGG + Intergenic
1157870931 18:51229574-51229596 GATAGCTCTTGGTCTGCTACTGG - Intergenic
1157998504 18:52588117-52588139 GACAGCTCTTGGCCTGTTACTGG - Intronic
1159152205 18:64535031-64535053 GACAGCTCTTGGCATGTTACTGG - Intergenic
1159287789 18:66375489-66375511 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1159559104 18:69975344-69975366 GACAGCTCTTGGCTTGTTACTGG - Intergenic
1159711301 18:71764131-71764153 GACAACTCTTGGTTTGTTACTGG + Intronic
1160092464 18:75840022-75840044 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1163864907 19:19764891-19764913 AACAGCTTTTGGCCTGTTCCTGG + Intergenic
1164097085 19:22021336-22021358 GACAACTCTTGGCCTATTACTGG - Intergenic
1164117257 19:22234567-22234589 GACAACTCTTGGCCTGTTACTGG - Intergenic
1164500508 19:28815476-28815498 TAGAGCTCTGGGCCTGTGAGGGG + Intergenic
925279953 2:2676875-2676897 GACAGCACTTGGCCTGTTACTGG + Intergenic
925460727 2:4060453-4060475 GACAGCTCTTTGTCTATTACTGG + Intergenic
925499407 2:4486917-4486939 GAAAGCTCTTGACTTGTTACTGG - Intergenic
926810395 2:16750669-16750691 GACAGCTCTTGGCCTGTTACTGG - Intergenic
926826763 2:16913675-16913697 GACAGATCTTGGCCTGTTACTGG + Intergenic
927008718 2:18879731-18879753 GACAGCTCTTGGCCTGTTACTGG + Intergenic
927660433 2:24988676-24988698 GACGGCTCTTGGCCTGTTACTGG + Intergenic
929227107 2:39522079-39522101 TAGACCTCTGGGCCTGTTATGGG + Intergenic
929269825 2:39960774-39960796 AACAGCTCTTGGCCTGTTACTGG - Intergenic
929550262 2:42886039-42886061 GACAACTCTTGGACTGTTACTGG + Intergenic
930295402 2:49547502-49547524 AAGAGCTCTTGGCCGGTTACTGG - Intergenic
930418605 2:51121002-51121024 GACATCTTTTGGCCTGTTACTGG + Intergenic
932594169 2:73083832-73083854 GAGTGCTCTAGCCCTGTTCCTGG - Intronic
932870706 2:75395074-75395096 GACAGCTCCTGGCCTGTTACTGG - Intergenic
933130412 2:78665635-78665657 GAGAGTTCTTGGCTTGTTCCTGG + Intergenic
933265684 2:80178373-80178395 GACAGCTCTTGGCCTGTTACTGG - Intronic
933394462 2:81713348-81713370 GACAGCTCTTGGCCTGTTACTGG - Intergenic
935183936 2:100714908-100714930 GACAGCTCTTGGCCTGTTACTGG + Intergenic
935425109 2:102911318-102911340 TACAGCTCTTGGCCTGTTACTGG - Intergenic
935564308 2:104590244-104590266 GACAGCTCTTGGCCTGTTACTGG - Intergenic
935944629 2:108274356-108274378 GACAGCTCTTGGCCTGCTACTGG - Intergenic
936641226 2:114314699-114314721 GACAGCTCTTGGCCTGTTACTGG + Intergenic
937133031 2:119527510-119527532 TAGAGCTCTTTGCATGGTACTGG + Intergenic
937785205 2:125887719-125887741 GACAGCTCTTGGCCTGTTACTGG - Intergenic
937852569 2:126648729-126648751 GACAGCACTTGGCCTGTTACTGG - Intergenic
938375539 2:130803381-130803403 GACAGCTCTTGGCCTGCTACCGG + Intergenic
938419444 2:131132663-131132685 GAGAGCTGTAGTCCTGTTAGGGG + Intronic
939069063 2:137517865-137517887 GGCAGCTCTTGGCCTGTTACTGG + Intronic
939128474 2:138205312-138205334 GAGGGCTCTGGGCCTGTGATGGG + Intergenic
939213873 2:139212249-139212271 GACAGCTCTTGGCCTGTTATTGG + Intergenic
939444381 2:142290010-142290032 GAGATTTCTTCTCCTGTTACAGG - Intergenic
939580741 2:143942503-143942525 GAGAGCTCTTGTGCTCTAACAGG + Exonic
939788685 2:146546104-146546126 GACAACTCTTGGCCTGTTACTGG - Intergenic
939806241 2:146778483-146778505 GACAGCTCTCGGCCTATTACTGG + Intergenic
940472089 2:154113118-154113140 GACAGCTCTAGACCTGTTACTGG - Intronic
940605915 2:155924279-155924301 GACAGCTCATGGCCTGTTACTGG - Intergenic
941330667 2:164174556-164174578 GACAGCTCTTTGCCTGTTACTGG - Intergenic
943239218 2:185362563-185362585 GACAACTCTTGGCCTGTTACTGG - Intergenic
943317928 2:186412310-186412332 GACAGCTCTTGGTCTGTTACTGG - Intergenic
943384063 2:187181081-187181103 GACAGATCTTTACCTGTTACTGG - Intergenic
943388130 2:187227145-187227167 GGCAGCTCTTGGCCTGTTACTGG + Intergenic
943517597 2:188907233-188907255 GACATCTCTTGGCCTGTTACTGG - Intergenic
945642179 2:212443846-212443868 GACAGCTCTTGGACTATTACTGG + Intronic
945717834 2:213380660-213380682 GACAGCTCTTGGCCTGTTACTGG - Intronic
945724810 2:213463421-213463443 TAGAGCTCCTGGCCTGTAATGGG - Intronic
945725844 2:213471486-213471508 GACAGATGTTGGTCTGTTACTGG - Intronic
946527867 2:220539958-220539980 GACAGCTCTTGGCCCGTTACTGG - Intergenic
946790922 2:223299769-223299791 GACAGCTCTTGGCCTGTTACTGG + Intergenic
947440714 2:230118657-230118679 GACAGCTCCAGGCCTATTACTGG - Intergenic
947440848 2:230120266-230120288 GACAGCTCTGGGCCTATTACTGG + Intergenic
1171132467 20:22666211-22666233 TAGAGCTCTGGGCCTGTGATGGG + Intergenic
1175597923 20:60250215-60250237 GTGGGCTCTTGGCATGTGACAGG + Intergenic
1176791680 21:13326127-13326149 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1176998161 21:15580193-15580215 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1177139415 21:17342260-17342282 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1177192843 21:17870906-17870928 GACAGCTCTTTGACTGCTACTGG - Intergenic
1177505560 21:22014173-22014195 GACAGCTTTTGGCCTGCTACTGG - Intergenic
1177913176 21:27056219-27056241 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1177933697 21:27316923-27316945 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1177991071 21:28037129-28037151 GACAGCTTGTGGCCTGTTACTGG - Intergenic
1178012661 21:28305184-28305206 GACAGCTCTTGGCCTGCTACTGG + Intergenic
1178060754 21:28851129-28851151 AACAGTTCTTGGCCTGTTACTGG - Intergenic
1178063299 21:28875348-28875370 AACAGCTCTTGGCCTGCTACTGG - Exonic
1178634467 21:34290206-34290228 GACAGCTCTTGGCCTGCTACTGG + Intergenic
1179383528 21:40921059-40921081 GACAGCTCTTGGCCTGCAACTGG + Intergenic
1179415149 21:41192512-41192534 GAGAGCTCTTGGCCTGTTACTGG - Intronic
1179988695 21:44934668-44934690 GAGACCTCTATGCCTGTTCCAGG + Intronic
1180137581 21:45871357-45871379 GAGAGCTGGTGCCCTGTGACTGG + Intronic
1180591146 22:16938358-16938380 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1181367436 22:22388935-22388957 GACAGCTCTTGGCCTATTACTGG - Intergenic
1181420654 22:22795840-22795862 GACAGCTGTTGGCCTGTTACTGG + Intronic
1181515118 22:23405717-23405739 GAGAGCGCATGGCCTGTTTGAGG - Intergenic
1184275951 22:43409949-43409971 GAGAGCTCTGCGCCTGGGACTGG + Intergenic
1184603560 22:45558366-45558388 GACAGCTCTTGGCCTGTTACTGG - Intronic
949125664 3:443137-443159 GACAGTTCTTTGCCTGTTACTGG - Intergenic
949170039 3:986595-986617 GACAGCTCTTGGCCTGTTACTGG - Intergenic
949245869 3:1924931-1924953 GACAGCTCTTGGTCTGTTACTGG + Intergenic
949445612 3:4131062-4131084 GACAGCTCTTGGCCTGTTACTGG + Intronic
949638780 3:6012525-6012547 GACAGCTCTCAGCCTGTTACTGG + Intergenic
949821819 3:8123910-8123932 TAGAGCTCTGGGCCTGTGATGGG + Intergenic
950319475 3:12036614-12036636 TAGAGCTCTGGGCCTGTGATGGG + Intronic
951122572 3:18945575-18945597 GGCAGCTCTAGGCCTGTTACTGG + Intergenic
951291518 3:20876737-20876759 GACAGCACTTGGCCTATTATTGG - Intergenic
951384526 3:22027543-22027565 GACAGCTCTTGGCCTGTTACTGG + Intronic
951523003 3:23626629-23626651 TAGAGCTCTGGGCCTGTGATGGG + Intergenic
951970762 3:28441857-28441879 GACAGCTCTTGGTCTGTTACTGG - Intronic
952491654 3:33879791-33879813 TAGAGCGCTTGTCATGTTACAGG + Intergenic
952605444 3:35142007-35142029 GACAGCCCTTGGCTTGTTACTGG - Intergenic
953546597 3:43868043-43868065 CAGAGCTCTGGGCCTCTTAAAGG + Intergenic
953655484 3:44849115-44849137 GAGAGCTATTGGGCTTTTTCTGG + Intronic
954054157 3:48007968-48007990 GTCAGCTCTTGGCCTGTTACTGG + Intronic
954511490 3:51129653-51129675 GGCAGCTCTTGGCCTGTTACTGG - Intronic
955035586 3:55264100-55264122 GACAGTTCTTGACCTCTTACTGG + Intergenic
956360453 3:68441446-68441468 GATAGCTCTTGGCCTGTTACTGG + Intronic
956509662 3:69980380-69980402 GACAGCTCTTGGCCTATTACTGG + Intergenic
956703894 3:71982879-71982901 GACAGCTCTTGGCCTATTACTGG - Intergenic
957298498 3:78361635-78361657 AACAGCTCTTGGCCTGCTGCTGG - Intergenic
957754598 3:84469434-84469456 GACAGCTCTTGGCCTGTTACTGG + Intergenic
958487677 3:94732466-94732488 GACAGCTCTTGGCCTGTTACTGG - Intergenic
958934303 3:100240636-100240658 GACAGCTCTGGACCTGTTACTGG + Intergenic
959203650 3:103279237-103279259 AATGGCTCTTGGCCTGTTACTGG - Intergenic
959226778 3:103597268-103597290 GACAGCTTTTGGCCTGTTACTGG - Intergenic
959439510 3:106359190-106359212 GACAACGCTTGGCCTTTTACTGG + Intergenic
959746013 3:109777265-109777287 GACAGCTTTTGGACTGTTACTGG - Intergenic
959997860 3:112698328-112698350 GAGAGCTCTTGGCCTGCTACTGG + Intergenic
960349530 3:116575709-116575731 GACAGCTCTTGGTCTGTTACTGG + Intronic
962364623 3:134769968-134769990 GAAAGCTCTGGGCATGATACAGG - Intronic
963115131 3:141721796-141721818 AAGAACTCTTGGTATGTTACTGG + Intergenic
963331816 3:143923365-143923387 GACAGATCTTGGCCTGTTACTGG - Intergenic
963453671 3:145516675-145516697 GACAGCTCTTGGCCTGTTACTGG + Intergenic
963661393 3:148132153-148132175 GACACCTCTTGACCTGTTACTGG + Intergenic
964255713 3:154772470-154772492 GAGAGGTATGGGCCTGTTGCTGG + Intergenic
964297673 3:155251929-155251951 AATAGCTCTTTTCCTGTTACTGG + Intergenic
964527453 3:157630549-157630571 GAGAGCTCCTGGGCAGTTACTGG - Intronic
964679244 3:159318906-159318928 GACAGCTCATGGCCTGTTACTGG - Intronic
965226766 3:166000756-166000778 GACAGCTCTTGGCCTGTTAGTGG - Intergenic
965244405 3:166248993-166249015 GAGGCCTCTCGGCCTGTTACCGG - Intergenic
965251332 3:166348259-166348281 GACAGCTCTTGGTCTGTTACTGG - Intergenic
965708643 3:171534771-171534793 AGCAGCTCTTGGCCTGCTACTGG - Intergenic
965893154 3:173540086-173540108 AACAGCTCTGGGCCTGCTACTGG - Intronic
966044329 3:175530913-175530935 GACAGCTCTTGGCCTGTTACTGG - Intronic
966445694 3:179998567-179998589 GACAGCTCTTGGTCTGTTACTGG + Intronic
966896732 3:184450552-184450574 AACGGCTCCTGGCCTGTTACTGG - Intronic
966933949 3:184693436-184693458 GAGAGCTGGTCGCCTGTTCCAGG + Intergenic
967831777 3:193925998-193926020 GACAGCTCTTGGCCTGTTACTGG + Intergenic
968438789 4:611036-611058 GAGTGCTCTTGGCCACTTGCAGG + Intergenic
968800184 4:2738129-2738151 GACAGCTCTTGGCCTGTTACTGG + Intergenic
968906947 4:3457975-3457997 GACAGCTCTTGGCCTGTTACTGG + Intergenic
969502097 4:7559404-7559426 GAGAGCTCTGGGCCTCCTCCAGG - Intronic
971857653 4:32062825-32062847 CAAAGCTCTTGACCTGTTACTGG - Intergenic
971897541 4:32617013-32617035 GACAGCTCTTGGCTTGCTACTGG + Intergenic
971979294 4:33732865-33732887 GACAGCTCTTGGCCTGCTATTGG - Intergenic
972095494 4:35342697-35342719 GAATGCTCTTGGCCTGTTACTGG + Intergenic
972805917 4:42529335-42529357 GACAGCTCTTGGCTTGTTACTGG + Intronic
972882960 4:43448146-43448168 GACAGCTGTTTGCCTGTGACTGG - Intergenic
973098053 4:46226768-46226790 GACAGCTCTTGGCCTCCTACTGG + Intergenic
973102925 4:46294760-46294782 GACAGCTCTTGGCCCATTACTGG + Intronic
973118443 4:46489051-46489073 GGCAGCTCTTGGCCTGTTACTGG + Intergenic
973120980 4:46520890-46520912 TACAGCTCTTGGCCTGTTACTGG - Intergenic
973143682 4:46798614-46798636 AATAGCTCTTGGCCTGCTACTGG + Intronic
974262370 4:59542261-59542283 GACAGCTCTTGGCCTGTTACTGG - Intergenic
974289570 4:59912750-59912772 AATAGCTCTTGGCTTGTCACTGG + Intergenic
974557606 4:63471907-63471929 GTTAGCTCTTGGTCTGCTACTGG + Intergenic
974644615 4:64674756-64674778 GACAGCTCTTGGCCTGTTACTGG - Intergenic
974727213 4:65812531-65812553 AACAGCTCTTGGCCTGTTACTGG + Intergenic
974746914 4:66088897-66088919 GACAGCTCTTGGTCTGTTACTGG - Intergenic
975024469 4:69531640-69531662 GACAGCTCATGGCCTGTTACTGG + Intergenic
975386716 4:73767501-73767523 GACAGCTTTTGGCCTGTTACTGG - Intergenic
975982614 4:80177269-80177291 GACAGCTCTTGGCCTGTTACTGG - Intergenic
976034205 4:80795814-80795836 GACAGATCTTGGTCTGTTAGTGG - Intronic
977031623 4:91891415-91891437 GACAGCTCTTTTTCTGTTACTGG + Intergenic
977204717 4:94155692-94155714 GACAGCTCTTGGCCTGTTACTGG + Intergenic
977430767 4:96928220-96928242 GACAGCTTTTGGCCTCTTACTGG + Intergenic
977466002 4:97383382-97383404 GACAACTCTTGGTCTGTTACTGG + Intronic
977490070 4:97700063-97700085 GACAGCTCTTGGCCTGTTACTGG - Intronic
977626275 4:99192646-99192668 GATAGCTCTTGGCCTGTTACTGG - Intergenic
977701730 4:100029879-100029901 GACAGCTCTTGGCCTGTTACTGG - Intergenic
977833274 4:101618160-101618182 GACAGCTCTTGGCCTGTTACTGG - Intronic
977930411 4:102743811-102743833 GACAGCTCTTGGCCTGTTACTGG - Intronic
978341589 4:107725541-107725563 GACAGCTTGTGGCCTGTTACTGG - Intergenic
978772151 4:112467772-112467794 GACAGCTTTTGGCCTGTTACTGG - Intergenic
978899074 4:113926810-113926832 GACAGCTCTTGGCCTGTTACTGG - Intronic
978966853 4:114750950-114750972 GACAGCTCTTGGGCTTTTACTGG + Intergenic
979767021 4:124474603-124474625 GACAGCTCTTGGCCTGTTACTGG + Intergenic
979888567 4:126062165-126062187 GATAGCTCTTGGCCTGCTATTGG - Intergenic
979898401 4:126189049-126189071 GAAAGCTCTTGGCCTTTTACTGG - Intergenic
980387946 4:132111173-132111195 GACAACACTTGGCCTGTTACTGG - Intergenic
980405890 4:132353783-132353805 GACAGCTTTTGGCCTGTTACTGG - Intergenic
980497526 4:133605354-133605376 GACAGCTCTTGGCCTGTTATTGG - Intergenic
980629523 4:135414294-135414316 GACAGCTCTTGGCCTGTTACTGG + Intergenic
980957732 4:139445925-139445947 GACAGCTTTTGGCCTGTTACTGG + Intergenic
981648412 4:147026929-147026951 GAGAGCTCTTGCCCTACTTCTGG - Intergenic
981835004 4:149043953-149043975 GACAGCTCTTGGCCTGTTACTGG + Intergenic
982623340 4:157732893-157732915 GACAGCTCTTGGCCTGTTACTGG - Intergenic
982835540 4:160116649-160116671 GAGAGCTCTTGGCCTGTTACTGG + Intergenic
982847770 4:160274304-160274326 GACAGCTCTTGGCCTGTTACTGG + Intergenic
982851048 4:160316648-160316670 AACAGCTTTTGGCCTGCTACAGG - Intergenic
982913506 4:161175630-161175652 GAGAGCCCCTGGCAAGTTACCGG - Intergenic
983027391 4:162755303-162755325 GACAGCTCTTGGCCTGTTACTGG + Intergenic
983582676 4:169324820-169324842 GACAGCTCTTGGCTTGTTACTGG + Intergenic
984060283 4:174982016-174982038 GACAGCTCTTGGCCTGCTACTGG - Intergenic
985893831 5:2737782-2737804 GAAAGCTGTTGGCCTGGCACCGG - Intergenic
986025575 5:3847422-3847444 GATAGCTCTTGGCCTGTTGCTGG + Intergenic
986037032 5:3950429-3950451 GACAGCTCTTGGCCTGTTACTGG - Intergenic
986087110 5:4462726-4462748 GACAGCTCTTGGCCTGTTAGTGG + Intergenic
986742920 5:10719514-10719536 GACAGCTCTTGGCCTGTTACTGG + Intronic
986938331 5:12918742-12918764 GACAGCTCTTGGCCTATTACTGG - Intergenic
986959839 5:13199227-13199249 GTCAGCTCTTTGCCTGTTACTGG + Intergenic
986985854 5:13500525-13500547 TAGAGCTCTGGGCCTGTGATGGG - Intergenic
987153177 5:15061674-15061696 AACAGCTCTTGGCCTGTTACTGG + Intergenic
987468188 5:18296976-18296998 GACAGCTCTTGGCCTATTACTGG - Intergenic
987578340 5:19758303-19758325 GGCAGCTCTTGGCCTGTTACTGG - Intronic
987646373 5:20677321-20677343 GACAGAACTTGGCCTGCTACTGG - Intergenic
987657137 5:20821643-20821665 GACAGGTCTTGGCCTATTACTGG - Intergenic
987885445 5:23806508-23806530 GATGGCTGTTGGCCTATTACTGG + Intergenic
987967647 5:24896349-24896371 GATAGGTCTTGGCCTGCTATTGG + Intergenic
988079830 5:26401411-26401433 GACAACTCTTGGCCTGTTACTGG - Intergenic
988107759 5:26772555-26772577 GACAGCTCTTGGCTTTTTGCTGG + Intergenic
988160824 5:27516862-27516884 GACAGATCTAGGCCTGTTACTGG - Intergenic
988169201 5:27632829-27632851 GTCAGCTTTTGGCCAGTTACTGG - Intergenic
988188776 5:27901245-27901267 GACAGCTCTTGGCCTGTTACTGG + Intergenic
988228769 5:28448135-28448157 GACAGCTCATGGCCTGTTACTGG + Intergenic
988562131 5:32290856-32290878 GACAGCTCTTGGCCCGTTACTGG + Intronic
988766414 5:34382305-34382327 GACAGGTCTTGGCCTATTACTGG + Intergenic
989045205 5:37267582-37267604 GACAGCTCTTGGCCTGTTACTGG - Intergenic
989307502 5:39974614-39974636 CACAGCTCTTGGCCTATAACTGG - Intergenic
989486383 5:41996350-41996372 GACAGCTCTTGGCCTGTTACTGG - Intergenic
989680424 5:44022640-44022662 TAGAGCTCTGGGCCTGTGATGGG - Intergenic
990777024 5:59314354-59314376 GAGAGCTCTTGGCCTTATAATGG + Intronic
991033545 5:62105931-62105953 GACAGCTCTTGGCCTGTTACTGG + Intergenic
991234168 5:64375172-64375194 AACAGCTTTTGGCCTATTACTGG + Intergenic
991330736 5:65489675-65489697 GACAGTTCTTGGCTGGTTACTGG - Intergenic
991946146 5:71900150-71900172 GACAGCTGTTGGCCTGTTACTGG + Intergenic
992242956 5:74789876-74789898 AACAGTTCTTGGCCTGTTACTGG + Intronic
992344705 5:75865096-75865118 AACAGCTCCTGGCATGTTACTGG + Intergenic
993231900 5:85247524-85247546 GACAGCTCTTGGCCTGTTACTGG - Intergenic
993319827 5:86458587-86458609 GATAGCTCTTGGCTTGTTACCGG + Intergenic
993367467 5:87050947-87050969 CACAGCTATTGGTCTGTTACTGG - Intergenic
993412581 5:87591803-87591825 GGAAGCTCTTGGCCTGTTACTGG - Intergenic
993780694 5:92062403-92062425 GACAGCTCTTGACTTGTTACTGG + Intergenic
993791792 5:92218920-92218942 GACAGTTCTTGGCCAATTACTGG + Intergenic
994291372 5:98031962-98031984 GACAGCTCTTGGCCTGTTACTGG - Intergenic
994855434 5:105113575-105113597 GACAGCTCTTGGCATGTTACTGG - Intergenic
994984419 5:106915720-106915742 GACAGCTCTTGGCCTGTTACTGG - Intergenic
994993084 5:107022851-107022873 GAGTGCTCTTTTCCTGTCACTGG - Intergenic
995427732 5:112043717-112043739 CAAAGCTCTTGGCCTGTTACTGG - Intergenic
995585254 5:113642250-113642272 TAGAGCTCTGGGCCTGTGATGGG - Intergenic
995776286 5:115727670-115727692 GACAGCTCTTGGCCTGTTACTGG - Intergenic
996018561 5:118567865-118567887 GACAGCTCTTGGTCTGTTACTGG + Intergenic
996164955 5:120212499-120212521 GACAGCTTTTGGCCTGTTACTGG - Intergenic
996825564 5:127677844-127677866 GACAGCTCTTGGCCTGTTATTGG + Intergenic
996912233 5:128668983-128669005 AACAGCTCTTGGCCTGTTACTGG + Intronic
998290335 5:140908542-140908564 GACAGCTCTTGGCCTATTACTGG - Intronic
999351386 5:150874854-150874876 GACAGCTCTTGGCCTGTCACTGG + Intronic
999618168 5:153447463-153447485 GCGAGCTCCTTGCCTGCTACTGG - Intergenic
1000223244 5:159234239-159234261 CACAGCTCTTGGCTTGTTACTGG - Intergenic
1000416973 5:160993911-160993933 GACAGCTCTTGGCCTGTTATTGG + Intergenic
1000422870 5:161058029-161058051 GAGAGCTCTTGGCCTGCTACTGG - Intergenic
1001173596 5:169444652-169444674 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1003000184 6:2324975-2324997 TAGGCCTCTGGGCCTGTTACAGG - Intergenic
1003695897 6:8406130-8406152 GACAGCTCTTGGCCTGTTACAGG - Intergenic
1003758608 6:9150091-9150113 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1003791221 6:9550001-9550023 GACAGCTCTTGGCCTATTACTGG + Intergenic
1004824288 6:19403226-19403248 GACAGCTCTTGGACTGTTACTGG - Intergenic
1005185170 6:23157082-23157104 GACAGCTGTTGGGCTGTTATTGG + Intergenic
1006001557 6:30969085-30969107 GACAGCTCTTGGCCTATTACTGG + Intergenic
1006062352 6:31433232-31433254 GACAGCTCTTAGCCTGTTACTGG + Intergenic
1008043485 6:46827999-46828021 GAGAGCTCTTGCATAGTTACAGG + Intronic
1008266921 6:49439279-49439301 GACAGCTCTTGGCCTGTTACTGG - Intronic
1008820399 6:55625162-55625184 GATAGCTCCTGGCCTGTTAATGG + Intergenic
1009390111 6:63135068-63135090 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1009660694 6:66606912-66606934 AACAGCTCTTGGCCTGTTACTGG - Intergenic
1009770333 6:68136842-68136864 GATAGCTCTTGGCCTGCTACTGG - Intergenic
1009806495 6:68606962-68606984 GACAGCTCCCGGCCTGTTACTGG + Intergenic
1010323578 6:74540499-74540521 GACACCTCTTGGCCTGTTACTGG + Intergenic
1010325329 6:74556589-74556611 GACATCTCTTGGCCTGTTACTGG - Intergenic
1010580752 6:77593895-77593917 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1010938245 6:81886407-81886429 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1011039343 6:83013264-83013286 AACAGGTCTTAGCCTGTTACTGG - Intronic
1011069102 6:83361675-83361697 GACAGCTCCTGGCCTGTTACTGG + Intronic
1012001906 6:93664456-93664478 GACAGCTTTTAACCTGTTACTGG + Intergenic
1012344589 6:98170329-98170351 GATAGCTGTTGGCCTATTACTGG + Intergenic
1012362990 6:98406675-98406697 AACAGCTCTTGGCGTGCTACTGG - Intergenic
1012730462 6:102874329-102874351 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1012820805 6:104082928-104082950 AACAGTTCTTGGCCTGTTACTGG + Intergenic
1012920794 6:105219535-105219557 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1013033633 6:106360392-106360414 GGCCGCTCTTGGCCTGTGACAGG - Intergenic
1013406672 6:109849812-109849834 GACAGTTCTTGGCCAGTTACTGG + Intergenic
1014363396 6:120508344-120508366 GAGAGCTCTTGGCCTGTTACTGG - Intergenic
1014416987 6:121195399-121195421 GACAGCTCTTGGCATGTTACTGG + Intronic
1014534196 6:122596612-122596634 GAGAGCTCTTGGCCTATTACTGG - Intronic
1014631641 6:123796811-123796833 GACATCTCTTGACCTGTTACTGG + Intergenic
1014895655 6:126896584-126896606 GACAGCTCTTGGCCTGATAATGG + Intergenic
1015095449 6:129409591-129409613 GACAACTCTTGGCCTGTTACTGG - Intronic
1015443284 6:133272555-133272577 GACAGCTCTTGGCCCATTACTGG - Intronic
1015475750 6:133657501-133657523 GACAGCTCTTGGCTTGTTACTGG + Intergenic
1015862094 6:137691851-137691873 GACAGCTTTTGGCCTGCTCCTGG + Intergenic
1015892632 6:137983760-137983782 AAGAGGTCTAGGTCTGTTACAGG + Intergenic
1016119914 6:140332682-140332704 GACAGTTCTTGGCCTATTACTGG - Intergenic
1016132838 6:140497997-140498019 AACAGCTCTTGGCCTGTAATTGG - Intergenic
1016144291 6:140649412-140649434 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1016147329 6:140692706-140692728 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1016174914 6:141069085-141069107 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1016419614 6:143870672-143870694 GACAGCTCTTGGCCTGTTACTGG - Intronic
1016453261 6:144205615-144205637 AAGAGCTTTTGGCCTGAGACTGG + Intergenic
1016576257 6:145572577-145572599 GACAGCTCTTGGTCTGTTACTGG - Intronic
1017044069 6:150330844-150330866 AACAGCTCTTGGCCTGCTACTGG - Intergenic
1017977115 6:159368047-159368069 GACAGTTCTTGGTTTGTTACTGG - Intergenic
1018122927 6:160655213-160655235 GACAGCTATTGGTCTGTTATTGG - Intronic
1018504415 6:164449024-164449046 GAGAGCTCATGGCATATTCCGGG - Intergenic
1018535030 6:164810484-164810506 GACCACTCTTGGCCTGTTACTGG - Intergenic
1018599888 6:165527536-165527558 GACAGCTATTGGCCTGGTACTGG + Intronic
1018803791 6:167242981-167243003 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1018904754 6:168069202-168069224 GAGGGTCCTTGGCCTGTTATGGG - Intronic
1019734926 7:2645891-2645913 GAGAGTTCTGGGCCTGAGACGGG + Intronic
1019922132 7:4169697-4169719 AAGAGCTCAGGGCATGTTACTGG - Intronic
1020396718 7:7725524-7725546 GACAGCTCTTGGCCTGTTACTGG + Intronic
1020710350 7:11597635-11597657 GACAGCTCTTGGCCTGTTACTGG + Intronic
1021001749 7:15340458-15340480 GAGGCCTCCTGGCCTGTGACAGG - Intronic
1021305091 7:19022517-19022539 AATAGCTCTTGGACTGCTACTGG - Intronic
1021988810 7:26122932-26122954 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1022078886 7:27000338-27000360 CACAGCTATTGGCCTGTTACTGG + Intergenic
1024040538 7:45550154-45550176 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1024744207 7:52388453-52388475 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1024866104 7:53906353-53906375 GACAGTTCTTGGCTTGTTACTGG + Intergenic
1024884342 7:54124645-54124667 GACAGTTCTTTGCCTATTACTGG - Intergenic
1027685798 7:81277964-81277986 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1027799766 7:82736452-82736474 AAATGCTCTTGGCCTGTTATTGG + Intergenic
1028141736 7:87281993-87282015 GACAGCTCTTGGCCTGTTATTGG + Intergenic
1028237821 7:88382830-88382852 GACAGCTCTTGGCCTATTACTGG + Intergenic
1028935014 7:96455072-96455094 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1029952785 7:104604378-104604400 TAGAGCTCTGGGCCTGTGATGGG + Intronic
1030368754 7:108674036-108674058 GACAGATCTTGGCCTGTTACTGG + Intergenic
1030457463 7:109793043-109793065 GACAACTCTTGGCCTGTTACTGG - Intergenic
1030931287 7:115525674-115525696 GACAGCTCTTGGCCCATTACAGG - Intergenic
1031236827 7:119188024-119188046 GACAGCTCTTGGCCTGTTACAGG + Intergenic
1031424387 7:121587659-121587681 GTGAGGTTTTGGCCTGTCACTGG - Intergenic
1031474446 7:122205344-122205366 GACAGACCTTGGCCTGTTACTGG - Intergenic
1031676558 7:124618373-124618395 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1031832996 7:126650025-126650047 GATAGCTCTTGTCCCGTTACTGG + Intronic
1031976532 7:128097215-128097237 GAGGGCTCTGGGCCCGTGACAGG - Intergenic
1032153104 7:129446949-129446971 GACAGCTCTTGGCCTGTTACTGG - Intronic
1032923470 7:136576107-136576129 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1033076258 7:138253054-138253076 GGCAGCTCTTGGCCTCTTACTGG + Intergenic
1037730010 8:21516402-21516424 AATAGGTCTTGGCATGTTACTGG - Intergenic
1037953618 8:23036110-23036132 AACAGCTCTTGGCTTGTTTCTGG + Intronic
1039324170 8:36466517-36466539 GATAGCCCTTGGCCTGTTGATGG - Intergenic
1040030984 8:42823422-42823444 GACAGCTCTTGACCTGCTAATGG - Intergenic
1040911946 8:52528426-52528448 GACAGCTCTTGGCGAGTTACTGG + Intergenic
1041934554 8:63321338-63321360 GACAGCTCTCGGCCTGTTACTGG + Intergenic
1041986182 8:63924481-63924503 GATAGCTCTTGGCCTGTCACTGG + Intergenic
1042001060 8:64123988-64124010 GACAGCTCTTGGCTTGTTACGGG - Intergenic
1042068182 8:64901928-64901950 GATAGCACTTGCCCTGCTACTGG + Intergenic
1042342421 8:67694359-67694381 GACAGCTCTTGGCCTGCTGCTGG + Intronic
1042363774 8:67912418-67912440 AAGAGCTCATGGTCTGTTAAAGG - Intergenic
1043259971 8:78184185-78184207 GAGCGCTCTTGACCTGGTACTGG - Intergenic
1044150800 8:88773083-88773105 GACAGCTCTTTGCCTGTTAGTGG + Intergenic
1044202390 8:89452496-89452518 GACAGCTCTTGGCCCATTACTGG + Intergenic
1044285973 8:90412438-90412460 GACAGCTCTTGTTCTGCTACTGG - Intergenic
1044487150 8:92767114-92767136 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1044633154 8:94298398-94298420 GGCAGCTCTTGGCTTGTTACTGG - Intergenic
1045221839 8:100207073-100207095 GACAGCTCTTGGCCTGTTACTGG + Intronic
1046128673 8:109941594-109941616 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1046197558 8:110884231-110884253 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1046417637 8:113937786-113937808 GACAGGTCTTGGCCTGTTACTGG - Intergenic
1046585785 8:116147711-116147733 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1047453631 8:124989321-124989343 GATAGCTCTTGGCCTGCTACTGG + Intergenic
1049461921 8:142734235-142734257 GAGAGATCTAGGCCTTTTAGGGG - Intronic
1049661031 8:143819841-143819863 GAGAGCTCTTGGCCTGCCTGGGG - Intronic
1050482675 9:6102611-6102633 GACAGCTCTTGGCCTATTACTGG + Intergenic
1051882147 9:21850670-21850692 GACTGTCCTTGGCCTGTTACTGG + Intronic
1051966463 9:22834585-22834607 GACTGCCCTTTGCCTGTTACTGG + Intergenic
1052227590 9:26108384-26108406 GACAGCTCTTGGCCTGTTACTGG + Intronic
1052442269 9:28512274-28512296 GTCAGCTCCTGGCCTGTTACTGG - Intronic
1052561525 9:30089748-30089770 GACGGCTCTTGCCCTGTTACTGG - Intergenic
1055678621 9:78691686-78691708 AAGAGCTTTTGGCTTGCTACTGG - Intergenic
1055903940 9:81271196-81271218 GATACCTCTTGGCCTGTTACTGG - Intergenic
1056156667 9:83845217-83845239 GACAGCTCTTGGCCTGTTACTGG + Intronic
1056231965 9:84556282-84556304 GAGAGCTCTCTGCCTGCTAATGG - Intergenic
1056314234 9:85372937-85372959 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1056353871 9:85778310-85778332 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1057058997 9:91986598-91986620 AACAGCTCTTGGCCTGCTACTGG + Intergenic
1057692729 9:97300590-97300612 GATAGCTTTTGACCTGCTACTGG - Intergenic
1057713217 9:97465978-97466000 GAGCGCTCTTGGACTGTGAGGGG + Intronic
1058239798 9:102542501-102542523 GACAGCTCTTAGCTTGCTACCGG + Intergenic
1058259255 9:102809660-102809682 GGTAGCACTTGGCCTGTTACTGG - Intergenic
1058544165 9:106042742-106042764 GACAGCTCTTGGCCTATTACTGG - Intergenic
1059196505 9:112375860-112375882 GACAGCTCTTAGCCTGTTACTGG - Intergenic
1059877079 9:118646943-118646965 GAGAGCTCTGGACCTGTCATGGG - Intergenic
1060178782 9:121517325-121517347 GACAGCTCTTGGCCTGCGGCTGG + Intergenic
1060805142 9:126570680-126570702 GATTGCTCTTGGCCTGGTACTGG - Intergenic
1061964642 9:134006116-134006138 GAAACCTCTGGGCCTGTTAGAGG + Intergenic
1062135472 9:134925031-134925053 GACAGCTCTTGACCTGTTACAGG + Intergenic
1186023738 X:5285600-5285622 GATAGCTCTTGGCTGGTTTCAGG + Intergenic
1186279496 X:7977126-7977148 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1186384093 X:9091754-9091776 GACAGCTCTTGGCCTGTTACTGG - Intronic
1186469766 X:9812101-9812123 TAAAGCTCTTGGCCTGTTACTGG - Intronic
1187604866 X:20871870-20871892 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1187743959 X:22387942-22387964 GAGAACTATTGGCCTGTTCCAGG - Intergenic
1189032440 X:37464272-37464294 AATAGCCCTTGGCCTGCTACTGG - Intronic
1189154883 X:38746714-38746736 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1190255320 X:48758146-48758168 AACAGCTCTTGGTCTGCTACTGG + Intergenic
1190527878 X:51346241-51346263 AATAGCTCTTGGCCTGCTACCGG - Intergenic
1190601537 X:52097827-52097849 AACAGCTCTTGGTCTGCTACTGG - Intergenic
1191095706 X:56671167-56671189 GACAGTTCTTGGCCTATTACTGG - Intergenic
1191134033 X:57044480-57044502 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1191629067 X:63301193-63301215 TAGAGCTCTGGGCCTGTGATGGG + Intergenic
1191630037 X:63312581-63312603 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1191658804 X:63629799-63629821 GACAGCTCTTGGCTTGTTACTGG - Intergenic
1191719241 X:64215702-64215724 GACAGCTCCTCGCCTGTTACTGG - Intergenic
1191742539 X:64451301-64451323 AACAGCTATTGGCCTGTTACTGG - Intergenic
1191759361 X:64629931-64629953 GACAGCTCTCAGCCTGTTACTGG + Intergenic
1191769494 X:64740091-64740113 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1191832729 X:65432316-65432338 GATCACTCTTGGCCTGCTACTGG - Intronic
1191932926 X:66394170-66394192 GACAGCTTTTGGCCTGTTACTGG + Intergenic
1191941261 X:66483858-66483880 GACAGTCCTTGGCCTGTTACTGG - Intergenic
1191946354 X:66539018-66539040 GACTGCTCTTGGTCTGTTACTGG + Intergenic
1192194167 X:69017615-69017637 GTGAGCTCTTGGCCTTGAACAGG + Intergenic
1192898704 X:75471916-75471938 GACAGCTCTTGGCCTATTACTGG + Intronic
1192996193 X:76515584-76515606 AACAGCTCTTGGCATGTTACTGG + Intergenic
1193053491 X:77125774-77125796 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1193297781 X:79852680-79852702 AACAGTTCTTGGCCTGTTACTGG + Intergenic
1193356256 X:80523129-80523151 GACAACTCTTGGCCTGTTACTGG + Intergenic
1193447157 X:81618777-81618799 GACAGCTCTTGGCCTATTACTGG + Intergenic
1193464937 X:81836786-81836808 AATAGTTCCTGGCCTGTTACTGG - Intergenic
1193643529 X:84040131-84040153 TAGGCCTCTTGGCCTGTTATGGG + Intergenic
1193832948 X:86310103-86310125 GACAGCTCTTGACCTGTTACTGG + Intronic
1193904486 X:87225837-87225859 GACAGCTCTTTGACTATTACTGG + Intergenic
1193914801 X:87351922-87351944 AACAGCTCTTGGCCTGTTACTGG - Intergenic
1193957285 X:87878216-87878238 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1194179590 X:90695929-90695951 GACAACTCTTGGCCTGTTACTGG - Intergenic
1194443550 X:93961109-93961131 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1194513417 X:94822246-94822268 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1194604389 X:95961962-95961984 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1194626616 X:96233172-96233194 GACAGTTCTTGGCCTGCTACTGG + Intergenic
1194824979 X:98550710-98550732 GAGAGCTCTTGGCCAACCACTGG + Intergenic
1194833959 X:98658810-98658832 GCGAGCTCTTGGCCTGTTACTGG + Intergenic
1194849245 X:98852168-98852190 GACAGCTCTTGGTCTGTTACTGG - Intergenic
1195069189 X:101262953-101262975 GAGAGCTCTTGGGCTGCTGAGGG + Exonic
1195228469 X:102822277-102822299 AACAGCTCTTGGCCTGCTAATGG + Intergenic
1195782352 X:108479859-108479881 GACAGCTCTTGGCCTGTTACTGG - Intronic
1196135968 X:112209837-112209859 GACAGCTCTTGGACTGTTACTGG - Intergenic
1197002290 X:121452930-121452952 GATAGCTCATGGTCTGTTACTGG + Intergenic
1197044415 X:121978331-121978353 GACAACTCTTGGCCTGTTACTGG + Intergenic
1197084195 X:122453493-122453515 GACAGCTCTTGGCTTGTTGCTGG - Intergenic
1197097469 X:122612844-122612866 GACAGGTTTTGGCCTGTTACTGG + Intergenic
1197245045 X:124158988-124159010 GACAGCTCTTGGCCTGTTACTGG - Intronic
1197372055 X:125637860-125637882 GGCAGCTCTTGGCCTGTTACTGG - Intergenic
1197380000 X:125727899-125727921 GACAGCTCTTAGCCTGTTACTGG - Intergenic
1197477358 X:126941323-126941345 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1197534717 X:127673485-127673507 AAGAGCTGTTGGCCTGCTACTGG + Intergenic
1197591866 X:128419393-128419415 GGCAGCTCTTAGCCTGTTACTGG + Intergenic
1197599207 X:128508037-128508059 TAGAGCTCTGGGCCTGTAATGGG - Intergenic
1198701301 X:139400302-139400324 GACGGCTCTTGGCCTGTTACTGG + Intergenic
1198783039 X:140257791-140257813 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1198934041 X:141887885-141887907 GACAGCTCTTGGCCTGTTACTGG + Intronic
1199021248 X:142881107-142881129 AACAGCTCTTGGCCTGCCACTGG + Intergenic
1199024380 X:142919725-142919747 GACAGCTCTTGGACTGTTACCGG + Intergenic
1199040592 X:143111106-143111128 GACAGCTCTTGGTCTGTTACTGG + Intergenic
1199144441 X:144348959-144348981 AACAGCTCTTGGCCTGTTACTGG - Intergenic
1199310426 X:146314394-146314416 GACAGCTCTTGGCCCGTTACTGG - Intergenic
1200289357 X:154857145-154857167 GATAGCTCTTGGCCTACTACTGG + Intronic
1200340494 X:155390636-155390658 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1200521271 Y:4212036-4212058 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1200526252 Y:4278098-4278120 GACAACTCTTGGCCTGTTACTGG - Intergenic
1200746057 Y:6904866-6904888 GATAGCTCTTGGCTTATTACTGG - Intergenic
1200973123 Y:9177704-9177726 GACAGCTCTTGGCCCATTACTGG - Intergenic
1200976630 Y:9218486-9218508 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1201529651 Y:14977888-14977910 GAAGGCTTTTGGCCTATTACTGG - Intergenic
1201798428 Y:17926705-17926727 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1201803125 Y:17979252-17979274 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1202134541 Y:21648071-21648093 GAGAGATCTTGGCCTGTTACTGG - Intergenic
1202137955 Y:21686809-21686831 GACAGCTCTTGGCCCATTACTGG + Intergenic
1202358013 Y:24072467-24072489 GACAGCTCTTGGCCCATTGCTGG - Intergenic
1202359748 Y:24095395-24095417 GACAACTCTTGGCCTGTTACTGG + Intergenic
1202511030 Y:25574719-25574741 GACAACTCTTGGCCTGTTACTGG - Intergenic
1202512765 Y:25597646-25597668 GACAGCTCTTGGCCCATTGCTGG + Intergenic