ID: 1014363402

View in Genome Browser
Species Human (GRCh38)
Location 6:120508382-120508404
Sequence AGTTATCTGAAAAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014363395_1014363402 16 Left 1014363395 6:120508343-120508365 CCCAGTAACAGGCCAAGAGCTCT 0: 4
1: 185
2: 205
3: 168
4: 223
Right 1014363402 6:120508382-120508404 AGTTATCTGAAAAAGATGGCAGG No data
1014363396_1014363402 15 Left 1014363396 6:120508344-120508366 CCAGTAACAGGCCAAGAGCTCTC 0: 4
1: 171
2: 199
3: 148
4: 205
Right 1014363402 6:120508382-120508404 AGTTATCTGAAAAAGATGGCAGG No data
1014363398_1014363402 4 Left 1014363398 6:120508355-120508377 CCAAGAGCTCTCTCTCAAAAGGA 0: 3
1: 192
2: 215
3: 180
4: 322
Right 1014363402 6:120508382-120508404 AGTTATCTGAAAAAGATGGCAGG No data
1014363393_1014363402 25 Left 1014363393 6:120508334-120508356 CCACCAAAGCCCAGTAACAGGCC 0: 144
1: 161
2: 86
3: 68
4: 218
Right 1014363402 6:120508382-120508404 AGTTATCTGAAAAAGATGGCAGG No data
1014363394_1014363402 22 Left 1014363394 6:120508337-120508359 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 1014363402 6:120508382-120508404 AGTTATCTGAAAAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014363402 Original CRISPR AGTTATCTGAAAAAGATGGC AGG Intergenic
No off target data available for this crispr