ID: 1014365424

View in Genome Browser
Species Human (GRCh38)
Location 6:120534887-120534909
Sequence GAGATGAAAATGGACTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014365424_1014365428 23 Left 1014365424 6:120534887-120534909 CCAGGAAAGTCCATTTTCATCTC No data
Right 1014365428 6:120534933-120534955 CTCACCCTTACTGCATCCAAGGG No data
1014365424_1014365427 22 Left 1014365424 6:120534887-120534909 CCAGGAAAGTCCATTTTCATCTC No data
Right 1014365427 6:120534932-120534954 TCTCACCCTTACTGCATCCAAGG No data
1014365424_1014365429 24 Left 1014365424 6:120534887-120534909 CCAGGAAAGTCCATTTTCATCTC No data
Right 1014365429 6:120534934-120534956 TCACCCTTACTGCATCCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014365424 Original CRISPR GAGATGAAAATGGACTTTCC TGG (reversed) Intergenic
No off target data available for this crispr