ID: 1014365429

View in Genome Browser
Species Human (GRCh38)
Location 6:120534934-120534956
Sequence TCACCCTTACTGCATCCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014365424_1014365429 24 Left 1014365424 6:120534887-120534909 CCAGGAAAGTCCATTTTCATCTC No data
Right 1014365429 6:120534934-120534956 TCACCCTTACTGCATCCAAGGGG No data
1014365425_1014365429 14 Left 1014365425 6:120534897-120534919 CCATTTTCATCTCGAGTTACATG No data
Right 1014365429 6:120534934-120534956 TCACCCTTACTGCATCCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014365429 Original CRISPR TCACCCTTACTGCATCCAAG GGG Intergenic
No off target data available for this crispr