ID: 1014365831

View in Genome Browser
Species Human (GRCh38)
Location 6:120540549-120540571
Sequence AGTATGTATGAGAGTAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014365827_1014365831 20 Left 1014365827 6:120540506-120540528 CCCTGTGACTGGGTTGATAGAGA No data
Right 1014365831 6:120540549-120540571 AGTATGTATGAGAGTAGAGGTGG No data
1014365828_1014365831 19 Left 1014365828 6:120540507-120540529 CCTGTGACTGGGTTGATAGAGAT No data
Right 1014365831 6:120540549-120540571 AGTATGTATGAGAGTAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014365831 Original CRISPR AGTATGTATGAGAGTAGAGG TGG Intergenic
No off target data available for this crispr