ID: 1014375300 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:120664774-120664796 |
| Sequence | TGTCCTTTGCAGGGCATGGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1014375300_1014375304 | -2 | Left | 1014375300 | 6:120664774-120664796 | CCATCCATGCCCTGCAAAGGACA | No data | ||
| Right | 1014375304 | 6:120664795-120664817 | CATGATCTCATTCTCGCTTTTGG | No data | ||||
| 1014375300_1014375305 | 16 | Left | 1014375300 | 6:120664774-120664796 | CCATCCATGCCCTGCAAAGGACA | No data | ||
| Right | 1014375305 | 6:120664813-120664835 | TTTGGCTGCATACTATTCTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1014375300 | Original CRISPR | TGTCCTTTGCAGGGCATGGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||