ID: 1014375300

View in Genome Browser
Species Human (GRCh38)
Location 6:120664774-120664796
Sequence TGTCCTTTGCAGGGCATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014375300_1014375304 -2 Left 1014375300 6:120664774-120664796 CCATCCATGCCCTGCAAAGGACA No data
Right 1014375304 6:120664795-120664817 CATGATCTCATTCTCGCTTTTGG No data
1014375300_1014375305 16 Left 1014375300 6:120664774-120664796 CCATCCATGCCCTGCAAAGGACA No data
Right 1014375305 6:120664813-120664835 TTTGGCTGCATACTATTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014375300 Original CRISPR TGTCCTTTGCAGGGCATGGA TGG (reversed) Intergenic
No off target data available for this crispr