ID: 1014378645

View in Genome Browser
Species Human (GRCh38)
Location 6:120711109-120711131
Sequence CATGTCATGTGCCACTGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014378645_1014378650 23 Left 1014378645 6:120711109-120711131 CCTTGGCAGTGGCACATGACATG No data
Right 1014378650 6:120711155-120711177 GACGGAGAGTCCACTGATTGTGG No data
1014378645_1014378651 24 Left 1014378645 6:120711109-120711131 CCTTGGCAGTGGCACATGACATG No data
Right 1014378651 6:120711156-120711178 ACGGAGAGTCCACTGATTGTGGG No data
1014378645_1014378647 0 Left 1014378645 6:120711109-120711131 CCTTGGCAGTGGCACATGACATG No data
Right 1014378647 6:120711132-120711154 AAGAGAGAATCTGTGCACTTGGG 0: 11
1: 48
2: 106
3: 220
4: 494
1014378645_1014378649 5 Left 1014378645 6:120711109-120711131 CCTTGGCAGTGGCACATGACATG No data
Right 1014378649 6:120711137-120711159 AGAATCTGTGCACTTGGGGACGG No data
1014378645_1014378646 -1 Left 1014378645 6:120711109-120711131 CCTTGGCAGTGGCACATGACATG No data
Right 1014378646 6:120711131-120711153 GAAGAGAGAATCTGTGCACTTGG 0: 6
1: 24
2: 61
3: 156
4: 556
1014378645_1014378648 1 Left 1014378645 6:120711109-120711131 CCTTGGCAGTGGCACATGACATG No data
Right 1014378648 6:120711133-120711155 AGAGAGAATCTGTGCACTTGGGG 0: 25
1: 71
2: 143
3: 220
4: 528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014378645 Original CRISPR CATGTCATGTGCCACTGCCA AGG (reversed) Intergenic
No off target data available for this crispr