ID: 1014378646

View in Genome Browser
Species Human (GRCh38)
Location 6:120711131-120711153
Sequence GAAGAGAGAATCTGTGCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 803
Summary {0: 6, 1: 24, 2: 61, 3: 156, 4: 556}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014378645_1014378646 -1 Left 1014378645 6:120711109-120711131 CCTTGGCAGTGGCACATGACATG No data
Right 1014378646 6:120711131-120711153 GAAGAGAGAATCTGTGCACTTGG 0: 6
1: 24
2: 61
3: 156
4: 556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014378646 Original CRISPR GAAGAGAGAATCTGTGCACT TGG Intergenic
901226433 1:7615595-7615617 AAAGAGAGAATCTGTACAAGTGG - Intronic
902097588 1:13959314-13959336 CAATAGAGATTCTGTACACTGGG - Intergenic
902291891 1:15440781-15440803 GAAGACAAAGTCTGTGCTCTCGG + Intronic
902449272 1:16486336-16486358 GAAGGGAGCATCTGTTCACTAGG - Intergenic
902468671 1:16633051-16633073 GAAGGGAGCATCTGTTCACTAGG - Intergenic
902505471 1:16936941-16936963 GAAGGGAGCATCTGTTCACTAGG + Intronic
902707906 1:18218983-18219005 GAGGAAAGAATCAGTGAACTTGG + Intronic
903154454 1:21434608-21434630 GAAGGGAGCATCTGTTCACTAGG + Intergenic
903643085 1:24873103-24873125 CAAGTGAGACACTGTGCACTGGG - Intergenic
904183804 1:28686852-28686874 TAAGCCATAATCTGTGCACTTGG + Intronic
907023632 1:51094186-51094208 AGAGAGAGAATCTGTGTGCTTGG + Intergenic
907119039 1:51992503-51992525 GAAGAAAGAATTTTTGCACAAGG - Intergenic
908363279 1:63390825-63390847 GAAGAGAGAATCTGTGTGTTTGG - Intronic
909084620 1:71155998-71156020 ACAGAGAGGATCTGTGCACTTGG - Intergenic
909197066 1:72640721-72640743 GAAGAGCAGAACTGTGCACTGGG - Intergenic
909209818 1:72808779-72808801 GGAGAGAGAAGCTGTGTACTTGG - Intergenic
909232893 1:73114862-73114884 GTGGAGAGAATCTGTGCAATAGG - Intergenic
909902970 1:81160892-81160914 GCACATAGAATCTGTGCACCTGG + Intergenic
909919179 1:81359097-81359119 GAAAAGAAAATCTGTGTAGTTGG + Intronic
910160429 1:84266730-84266752 GTCAAGAGACTCTGTGCACTTGG - Intergenic
910289651 1:85588022-85588044 GTGCAGAGAATCTGTGCTCTTGG + Intergenic
910470530 1:87547771-87547793 GGAGAGAGAATCTGTGTGCTTGG - Intergenic
910515494 1:88055120-88055142 GGAGAGAGAATCCGTGTACTTGG - Intergenic
910627403 1:89322723-89322745 GGAGAGAGAATCTGTGTGCTTGG - Intergenic
910639889 1:89447680-89447702 GGAGAGAGAATCTGTGTATTTGG - Intergenic
910733013 1:90420086-90420108 GAAGAGCGTTTCTGTGCCCTGGG + Intergenic
911011602 1:93287154-93287176 ACAGGGAGAATCTGTGCTCTTGG + Intergenic
911241478 1:95471747-95471769 AGACAGACAATCTGTGCACTTGG - Intergenic
911486319 1:98511008-98511030 AAAGATAAAATCGGTGCACTTGG - Intergenic
911487053 1:98515573-98515595 GGAGAGAGAATCTATACACTTGG + Intergenic
911586581 1:99698034-99698056 GAAAACAAAATCTGGGCACTAGG + Intergenic
912015233 1:105026662-105026684 GGAGAGAGAATCTGTTTTCTTGG + Intergenic
912242528 1:107926610-107926632 AGAGAGAGAATCTGTGCACATGG + Intronic
912316302 1:108670228-108670250 GCACAGAGAGTCTATGCACTTGG + Intergenic
912616885 1:111110731-111110753 GAAGAGAGAATCTCTGTGCTTGG - Intergenic
912633377 1:111268326-111268348 GGAGATGGAATCTGTGCACGTGG - Intergenic
913106122 1:115615737-115615759 GAAGAAAACCTCTGTGCACTTGG - Intergenic
913147195 1:116003650-116003672 GAAGAGAGAATCTGTGTGCTTGG - Intronic
913721887 1:121604321-121604343 GAAGAAAGAATTAGTGAACTCGG - Intergenic
913741671 1:121851903-121851925 GAAGAAAGAATTAGTGAACTCGG - Intergenic
914216322 1:145633182-145633204 GAAGAGACAACCTATGGACTGGG - Intronic
914415090 1:147472392-147472414 GGAGAGCTAATCTGTTCACTGGG + Intergenic
914443635 1:147729792-147729814 GAAGAGACAATCTGTTGATTGGG - Intergenic
914468894 1:147955841-147955863 GAAGAGACAACCTATGGACTGGG - Intronic
914958418 1:152185217-152185239 GAAGAGAGGATGTTTGCATTTGG + Intergenic
915185820 1:154104510-154104532 AGAGAGAGAATCTGTGCACCTGG + Intronic
915667025 1:157454357-157454379 GAAGAAAGAATCTGACCACAGGG - Intergenic
916633709 1:166644855-166644877 GAAGAGATAATCTGTTGAATGGG + Intergenic
916920539 1:169461431-169461453 GAAGAGAGAATGAGGACACTGGG - Intergenic
917191245 1:172421824-172421846 GGAGAGAGAATCTGTGCACTTGG + Intronic
917300683 1:173570858-173570880 AGAGAGAGAATCTGTGCACTTGG - Intronic
917433453 1:174995768-174995790 GAAGAGAGGATATGTAAACTTGG - Intergenic
917476424 1:175373134-175373156 GAAGAGAGGATATCTGGACTGGG + Intronic
917986752 1:180327348-180327370 GGAGAGAGAATCTGTGCACTTGG - Intronic
918752689 1:188292513-188292535 AGAGAGAAAAACTGTGCACTTGG + Intergenic
919147340 1:193651961-193651983 AGAGAAAGAATCTGTGCATTTGG - Intergenic
919169697 1:193938526-193938548 GAAGAGAGAATCTGTGCACTTGG + Intergenic
919320905 1:196036807-196036829 GAAGAGACAATCTGTTGAATGGG - Intergenic
919436511 1:197568987-197569009 GAAGAGACAATCTCTGCAATGGG + Intronic
919455764 1:197818245-197818267 AAAGAGAGAATCTGTGCTTTGGG + Intergenic
920595054 1:207260324-207260346 AGAGAGAGAATCTGTGTGCTTGG - Intergenic
921057443 1:211554081-211554103 GAAAAGATAATCTATACACTAGG - Intergenic
921146940 1:212367338-212367360 GCAGAGAGAATCTGTGAGCTTGG + Intronic
921929509 1:220743582-220743604 CAAGAGAGAGTCTGTGCTCTTGG - Intergenic
922358231 1:224796486-224796508 GGAGGGAGAATTTGTGCAGTTGG - Intergenic
924399836 1:243667290-243667312 AAAGACAGAAACTGTGCTCTGGG + Intronic
1063098205 10:2926747-2926769 CAGGAGAGAATTTGTGCCCTAGG - Intergenic
1065051474 10:21796882-21796904 GAAGAGACAAACCATGCACTGGG - Intronic
1065149805 10:22811182-22811204 GAAGAGAGAATAGGAGCACCTGG - Intergenic
1065274970 10:24076543-24076565 AAAGAGAGAATCTGTGCACATGG - Intronic
1065566781 10:27019371-27019393 GAAGAGAGAATCTGTAGAATGGG + Intronic
1065904240 10:30234761-30234783 GATTAGAGAATCAGTGAACTGGG + Intergenic
1065921710 10:30398933-30398955 TGAGAGAGAATCTGTGCACTTGG + Intergenic
1065986387 10:30957329-30957351 GAAGAGACAATCTGTAGAATGGG - Intronic
1066585632 10:36931508-36931530 GAAAAGGTAATGTGTGCACTTGG + Intergenic
1067396064 10:45919821-45919843 GAGGAAAGAATCAGTGAACTTGG - Intergenic
1067864381 10:49888939-49888961 GAGGAAAGAATCAGTGAACTTGG - Intronic
1067958084 10:50815764-50815786 AAAGTTTGAATCTGTGCACTAGG + Intronic
1069056152 10:63847090-63847112 AGAGAGAGAATCTGTGCATTTGG + Intergenic
1069220948 10:65882601-65882623 GAAGAGATAATCTATGGAATAGG - Intergenic
1069343311 10:67438715-67438737 AGAGAGAGAATCTGTGCACAAGG + Intronic
1069807424 10:71134687-71134709 GAGGAAAGAATCTGAGGACTTGG - Intergenic
1071189856 10:83086489-83086511 AAAGAGAGAATCAGTGAACTTGG + Intergenic
1071246919 10:83774967-83774989 GAAAAGAGAATCTCAGAACTTGG + Intergenic
1071896844 10:90076850-90076872 GGTGAGAGAATCTGTGCATTTGG - Intergenic
1071938864 10:90564294-90564316 GAAAAGACAATCTATGCAATGGG - Intergenic
1071962543 10:90821304-90821326 GCATAGAGAATCCGTGCACTTGG + Intronic
1072058663 10:91787359-91787381 AGAGAGAGAATCTGTGTGCTTGG + Intergenic
1072492507 10:95921343-95921365 GAAGAGAGAATCTGTGCACTTGG - Intronic
1073827219 10:107337504-107337526 CCAGAGAGAATCTGTGCACTTGG - Intergenic
1073872307 10:107879629-107879651 GGAGAGAGAATCTGTGCACTTGG + Intergenic
1074410493 10:113223978-113224000 GAAGAGAACATCCTTGCACTTGG + Intergenic
1074691357 10:116007480-116007502 GAAGATAGAATCTGGGGACAGGG + Intergenic
1075340185 10:121641245-121641267 CACCAGAGAATCTGTGCAATAGG + Intergenic
1075830651 10:125408086-125408108 GGAGAGAGAATCTATGTGCTTGG - Intergenic
1076376702 10:129993120-129993142 GGAGAGAGAATCTGTGCACTTGG + Intergenic
1077424931 11:2470917-2470939 AAACAGAAAATCTGTGCCCTTGG - Intronic
1077427323 11:2489216-2489238 GGAGAGAGAATCTGAGAGCTTGG + Intronic
1078309349 11:10223793-10223815 GGAGAGATAAACTGTTCACTTGG + Intronic
1078690776 11:13578709-13578731 AGAGAGAGAATCTGTGCACTTGG + Intergenic
1078982045 11:16546816-16546838 GAAGAGATAACCTGTGGAATGGG + Intronic
1078992517 11:16664361-16664383 GGAGAAAGAATCTGTACACTTGG + Intronic
1079530655 11:21448028-21448050 TCAGAGAGAATCTGTGCGTTTGG - Intronic
1079571719 11:21952112-21952134 GGAGAGTGTTTCTGTGCACTGGG + Intergenic
1079823244 11:25158857-25158879 GAAGAAAGAATTAGTGGACTTGG - Intergenic
1080128462 11:28765885-28765907 AGAGAGAGATTCTGTGCATTTGG + Intergenic
1081073828 11:38643180-38643202 AGAGAGAGAATCTGTGCACTTGG - Intergenic
1081351624 11:42060401-42060423 GAAGAAGGAATCTATGCACATGG + Intergenic
1081763210 11:45591516-45591538 GAAGAGAGACTCTGGGGGCTGGG - Intergenic
1082934531 11:58642639-58642661 CAAGAGAGAGTCTGTTCAATTGG + Intronic
1083512893 11:63227961-63227983 GCACAGAGAATCTGTGCACTTGG - Intronic
1084339925 11:68490692-68490714 GAAGAAAGAATCTGAGCATTAGG - Intronic
1084365748 11:68696752-68696774 GAGGAAAGAACCTGTGAACTTGG + Intergenic
1085217843 11:74848124-74848146 GAAGATGGACTCTGTGCTCTTGG + Exonic
1085878663 11:80439460-80439482 GCAGAGAGAATCTGAGGTCTTGG + Intergenic
1086249843 11:84799353-84799375 CAAGAGAGAATCTGTGCACTTGG - Intronic
1086672753 11:89567582-89567604 GAAGAGAGAATGAGTGCAGAGGG + Intergenic
1087032142 11:93716308-93716330 GGAGAGAGAATCTGTATGCTTGG - Intronic
1087133023 11:94685336-94685358 GAAGAAAGAATTAGTGAACTCGG + Intergenic
1087299185 11:96412939-96412961 GGAGAGAGAATATGTACTCTTGG + Intronic
1087598533 11:100284087-100284109 GAAGAGAAAATCTGTTTGCTTGG - Intronic
1087691150 11:101321568-101321590 GGAGAGAGAATCTGTATTCTTGG - Intergenic
1087721083 11:101665901-101665923 GCACAGAGAGTCTGTGCACTTGG - Intronic
1088132758 11:106514067-106514089 GAAGAGACAATCTATGGAATGGG + Intergenic
1088419883 11:109634610-109634632 GAAAAAAGAATCTGTGAACTTGG - Intergenic
1088588713 11:111381975-111381997 GAAGAAAAAATCTGTGAACATGG + Intronic
1088944587 11:114496338-114496360 AGAGGGAAAATCTGTGCACTTGG - Intergenic
1088960726 11:114662207-114662229 GGAGAGTGTTTCTGTGCACTGGG + Intergenic
1088985077 11:114898781-114898803 GGAGAGAAAATCTGAGAACTTGG + Intergenic
1089444232 11:118539040-118539062 GAAGAGACAATCTGTTGAATGGG - Intronic
1090112153 11:123924462-123924484 GAAGAGACAACCTATGGACTGGG - Intergenic
1090317597 11:125807801-125807823 GCACAGAGACCCTGTGCACTTGG + Intergenic
1090436349 11:126689821-126689843 GCACAGAGAATCGGTGCCCTTGG + Intronic
1091275970 11:134350451-134350473 GGAGAGAGGATCTGTGCATTTGG - Intronic
1092497508 12:9011791-9011813 GGAGAGAGAGTCTGTGCTTTGGG + Intergenic
1092670751 12:10858293-10858315 GAATGGAGAATCTGTAGACTTGG + Intronic
1093062120 12:14618052-14618074 GAAGAGAGAAAATAAGCACTGGG - Intronic
1093324914 12:17761264-17761286 AAAGAGATCGTCTGTGCACTTGG - Intergenic
1093538091 12:20247241-20247263 GGAGAGAGAATCTATGTGCTTGG + Intergenic
1093619886 12:21276712-21276734 GGAGAAGGAATCTGAGCACTTGG + Intronic
1094057253 12:26279928-26279950 GAAGAGAGAGTGTGTAGACTGGG + Intronic
1094440389 12:30469562-30469584 GAAGAGACAATCTGTTGAATGGG - Intergenic
1095054211 12:37581243-37581265 GGCAAGGGAATCTGTGCACTTGG - Intergenic
1095181830 12:39154831-39154853 GCAAAGAGAATCTGTGCACTTGG - Intergenic
1095227396 12:39694411-39694433 GGAGAGTGATTCTGTGTACTGGG + Intronic
1095860135 12:46907776-46907798 AGAGAGAGAATCTGTGCACTTGG + Intergenic
1095878494 12:47107105-47107127 GAACAAAGAATCAGGGCACTTGG - Intronic
1097508508 12:60506907-60506929 AAAGAGAAAGTCTGTGCACTTGG + Intergenic
1097899393 12:64857925-64857947 GGAGAAAGAGTCTGTGCACTTGG - Intronic
1098395195 12:70010187-70010209 GGAGAGACAATCTGTGCACTTGG + Intergenic
1098503837 12:71226538-71226560 AGAGAAAGAATCTGTGCACTTGG + Intronic
1098667484 12:73181486-73181508 GAAGAGATAATCTGTGAGCTTGG - Intergenic
1098736734 12:74113877-74113899 GAAGAGATAATCTGTACACTTGG - Intergenic
1098922734 12:76317367-76317389 TAAGAGAAAATCTGTGTCCTTGG + Intergenic
1099043291 12:77682620-77682642 GAAAAGAGAACCTTTGCACATGG - Intergenic
1099101018 12:78440120-78440142 GGAGAGAGAATCTGTGTGCTTGG - Intergenic
1099548558 12:84014308-84014330 GGAGAGAGAATCTGTGCACATGG - Intergenic
1099807827 12:87542786-87542808 CAGGAGGGAATCAGTGCACTTGG + Intergenic
1099862487 12:88237765-88237787 GAAGAAAGAATCAGTGAACTTGG - Intergenic
1100026406 12:90134133-90134155 CTAGAAAGAATCTCTGCACTTGG - Intergenic
1100904802 12:99285730-99285752 GGAGAGAGAATCTGTGTGCTTGG + Intronic
1100996736 12:100308922-100308944 AGAGACATAATCTGTGCACTTGG - Intronic
1102266509 12:111490784-111490806 GGAGAAAGAATCTGTGTGCTCGG + Intronic
1103416060 12:120742004-120742026 CAAGAGCCAGTCTGTGCACTCGG + Intergenic
1103923978 12:124413669-124413691 GGAGAGAGGGGCTGTGCACTGGG + Intronic
1105799966 13:23894475-23894497 GAAGAGGGAGTGTGTGCAATGGG + Intronic
1105849069 13:24318520-24318542 GAAGAGGGAGTGTGTGCAATGGG - Intronic
1105938133 13:25120738-25120760 GGAGAGAGAATCTTTGTGCTTGG + Intergenic
1106170039 13:27280812-27280834 GAAGAGAGAATGTGGCCAGTGGG - Intergenic
1106490621 13:30218036-30218058 GAAGAGAGAACCTGGGAAATGGG + Intronic
1106550630 13:30767929-30767951 AAAGAGATAATCTGTGCAACTGG + Intergenic
1107177988 13:37422403-37422425 AGAGAGAGAATCTGTGCACTTGG + Intergenic
1107578392 13:41752761-41752783 AATGAGAGAATGTGTGCAATGGG - Intronic
1107582141 13:41802191-41802213 GGAGAAAGAATCTGTGTGCTTGG + Intronic
1107614137 13:42147066-42147088 GATGAGAGACTTTGTGCACAAGG + Intronic
1108137832 13:47384997-47385019 ACAGAGAGAATCTGTGCACTTGG + Intergenic
1108857931 13:54819246-54819268 GGAGAGAGAATCTGTGTACTTGG + Intergenic
1109031078 13:57188988-57189010 GAAGAAATAATATGTGCACAAGG + Intergenic
1109211371 13:59538988-59539010 GGAGAGAGAGTCTATGCACTTGG - Intergenic
1109352049 13:61195392-61195414 TCGGAGAGAACCTGTGCACTTGG + Intergenic
1109583705 13:64371851-64371873 AAAGAGAGAATCTGTTTTCTTGG - Intergenic
1109824204 13:67696905-67696927 CGAGAAAGAATCTATGCACTTGG + Intergenic
1109854600 13:68110771-68110793 ACAGAGAGAATCTATGCATTTGG + Intergenic
1109900484 13:68762935-68762957 CAAGAGAGAATCTGTGAAACTGG + Intergenic
1109935127 13:69272428-69272450 GAAGAGAGACTCTGGATACTTGG - Intergenic
1110040086 13:70743693-70743715 GAAGAGAGCATCAGTAAACTGGG - Intergenic
1110053836 13:70939724-70939746 GAAGAGAGAAACTCTGATCTTGG - Intergenic
1111085925 13:83374689-83374711 GGAGAGAGAATTTGTGTGCTTGG - Intergenic
1111542587 13:89688769-89688791 GTACAGAGAGTCTGTGTACTGGG + Intergenic
1111583457 13:90253768-90253790 GGAGAGAGAACCTGTGTGCTTGG - Intergenic
1111934224 13:94542889-94542911 GAACAGAGAAACTGTGTCCTTGG - Intergenic
1112176850 13:97034331-97034353 GGAGAAAGAATCTGTGAGCTTGG + Intergenic
1112706634 13:102077350-102077372 GAAGAGACAGTCTGTGAAATGGG + Intronic
1112743207 13:102497771-102497793 GCAGAGAGAATCTGTGTGCTTGG + Intergenic
1112940312 13:104854118-104854140 AGAGAGAGAATTTGTGCACTTGG + Intergenic
1112944508 13:104910774-104910796 GAAGAGAGAATCTGTGCACTTGG - Intergenic
1112972886 13:105282588-105282610 GATCTGAGAACCTGTGCACTTGG + Intergenic
1113213022 13:108004074-108004096 AAAGAGAGAATCTGTACACTTGG - Intergenic
1113244434 13:108378279-108378301 GGAGAGAGAATCTATGTAGTCGG - Intergenic
1113652352 13:112043201-112043223 AAAGAGAGAATTTGTGAACTGGG - Intergenic
1114539366 14:23443327-23443349 GCAGAGAGAATAGGTGCACGCGG + Intergenic
1114761704 14:25322997-25323019 GCACAGAGAATTTGTGCTCTTGG - Intergenic
1114971546 14:28035914-28035936 GAACAGACAATCTGTGGAATGGG + Intergenic
1115282508 14:31679120-31679142 GCACAGAGAATCTGTGTGCTTGG - Intronic
1115660880 14:35493581-35493603 GAAGAGAGAATTTGTGTACTTGG + Intergenic
1115893642 14:38060283-38060305 GAAGAGGGAAGTTGTGGACTGGG + Intergenic
1115918239 14:38342009-38342031 AGAGAGAAAAACTGTGCACTTGG + Intergenic
1115930079 14:38481813-38481835 GGAGAGAGAATCTGTATGCTCGG + Intergenic
1116317451 14:43416616-43416638 GAGGAGAGAATCTCAGAACTTGG - Intergenic
1116480942 14:45391307-45391329 GCATAGAGAATCTGTGTGCTTGG + Intergenic
1116725263 14:48554743-48554765 GCAGAGAGAATCTATGTGCTGGG - Intergenic
1116888940 14:50248975-50248997 GGAGACAGAACCTATGCACTTGG + Intronic
1117110259 14:52446236-52446258 GAAGAGAGAATCTATGTGTTTGG + Intronic
1117504552 14:56389134-56389156 GGAGAGAAAATCTGTGCACTTGG - Intergenic
1117596461 14:57331270-57331292 TAACAGAGTAACTGTGCACTGGG - Intergenic
1117870649 14:60197426-60197448 TGAGAGAGAATCTGTGCATTTGG + Intergenic
1117994380 14:61465161-61465183 GAAGAGACAACCTGTGGAATGGG - Intronic
1118140987 14:63082356-63082378 GAAGAGACAATCTGTAGAATGGG + Intronic
1118189024 14:63563940-63563962 GAAAAGAGAATCTGGGGGCTGGG + Intergenic
1118241286 14:64060955-64060977 GGAGAAAGAATCCGTGCACGTGG - Intronic
1118543427 14:66857833-66857855 GGAGAGAGAATCTGTGCATTTGG + Intronic
1118962283 14:70545315-70545337 GCACAGAGAATCTGCGCACTTGG + Intergenic
1119067052 14:71539307-71539329 GAATAGAGAATATTTACACTAGG - Intronic
1119295035 14:73526112-73526134 GGAGAGAGAATCTGTGCATGTGG + Intronic
1119871345 14:78020601-78020623 GGAGAGAGAATCTGAGGTCTAGG + Intergenic
1120099999 14:80434448-80434470 GGAGAGAGAATCTGTGTGCTTGG + Intergenic
1120467843 14:84884514-84884536 TGAGAGAGAATCTGTGTGCTTGG + Intergenic
1120623386 14:86793010-86793032 GTAGAGATAACCTGTGCAATAGG - Intergenic
1121375823 14:93410127-93410149 GGAGAGAGAATCTGGACACTTGG + Intronic
1123502461 15:20902439-20902461 GTAGACAGAATCTGTACACTTGG + Intergenic
1123559711 15:21476106-21476128 GTAGACAGAATCTGTACACTTGG + Intergenic
1123595945 15:21913405-21913427 GTAGACAGAATCTGTACACTTGG + Intergenic
1125432939 15:39615315-39615337 AAAGAGACAATCTGTGAAGTAGG + Intronic
1126045644 15:44637166-44637188 GAAGAAAGAATTAGTGCACTGGG + Intronic
1126486651 15:49188450-49188472 GGAGAGAGAAGCTGTGCACATGG - Intronic
1126519196 15:49571289-49571311 GAAGAGAGAACCTGTAGAATGGG - Intronic
1126654555 15:50962806-50962828 GAAGAAACAATCTGTAGACTGGG + Intronic
1126716552 15:51524575-51524597 TGAGAGAGTTTCTGTGCACTGGG + Intronic
1127019280 15:54727646-54727668 AAAGAGAGAGCCTGTGCTCTTGG - Intergenic
1127441594 15:59014338-59014360 CAAGTCAGAATCTGAGCACTAGG + Intronic
1127805165 15:62512587-62512609 GAAGAAAGAAAATGTACACTCGG - Intronic
1127971654 15:63966759-63966781 GGAGAAAGAACCTGTGCACTTGG - Intronic
1127991113 15:64118242-64118264 GAGGTGAGGATCTGTGCTCTTGG + Exonic
1129145762 15:73645771-73645793 GAAAAAAGAATCTGTTAACTTGG - Intergenic
1130511669 15:84594792-84594814 GCTGAGAGAATCTGTGCACTTGG + Intergenic
1131371202 15:91883278-91883300 GAAGAGAGAAACTTGGCACCGGG + Intronic
1202968053 15_KI270727v1_random:203268-203290 GTAGACAGAATCTGTACACTTGG + Intergenic
1134407167 16:13970610-13970632 GCACAGAGAATCTGTGCACTGGG - Intergenic
1136389305 16:29952329-29952351 ACAGAGAGAAACTGTGCACTTGG - Intronic
1137258149 16:46795333-46795355 GAAGAGATAATCTGTTGAATGGG + Intergenic
1137521824 16:49201455-49201477 GAAGAGAGATTCCCTGCAATGGG - Intergenic
1137566837 16:49538576-49538598 GAAGAGTGCAGCTTTGCACTGGG - Intronic
1138806936 16:60100932-60100954 GGAGAGAGAATCTATGCATTTGG - Intergenic
1138831583 16:60381361-60381383 GAAGAAGGAATCTGTGCAAGGGG + Intergenic
1139233232 16:65307536-65307558 GAAGGGAGAAGCTGTGGTCTGGG - Intergenic
1140716527 16:77731016-77731038 GAAAAGACAATCTGTGGAATGGG - Intronic
1141153308 16:81579537-81579559 GAAGAGGGAAAATGTGGACTTGG + Intronic
1141936518 16:87242636-87242658 GAAGGCAGAAACTGTGCACATGG + Intronic
1142285635 16:89170460-89170482 GCAGGCAGCATCTGTGCACTTGG - Intergenic
1142781815 17:2187004-2187026 AAAGAGAGAACCAGTGTACTGGG + Intronic
1143179837 17:4977653-4977675 GACCAGAGAATCTGGGGACTGGG - Intronic
1143266360 17:5641051-5641073 GAAGAAAGAAGCTGTTCACAGGG - Intergenic
1144510956 17:15876032-15876054 TAACAGGGAATCTGTGCACCAGG - Intergenic
1145175115 17:20693722-20693744 TAACAGGGAATCTGTGCACCAGG - Intergenic
1145371504 17:22310480-22310502 GGTAAGGGAATCTGTGCACTTGG - Intergenic
1145785695 17:27592533-27592555 GAGGACAGAATCTGTCCCCTCGG + Exonic
1146629077 17:34457342-34457364 GATGACAGAATCTGTGAGCTCGG - Intergenic
1146943085 17:36857316-36857338 GGAGAGAGCATCTGTGAGCTGGG - Intergenic
1147986892 17:44311999-44312021 GAAGGGGGTATCTGTGTACTGGG + Intronic
1148929342 17:51115480-51115502 GAAGAGAGAATATCTTTACTGGG - Intronic
1149141413 17:53436992-53437014 GAAGCAAGAAGATGTGCACTGGG - Intergenic
1149249349 17:54750059-54750081 AGAAAGAGAATCTATGCACTTGG - Intergenic
1149678851 17:58489689-58489711 GGAGAGAGACTCTGGGCTCTTGG - Exonic
1150541386 17:66103798-66103820 GAAGAGAGAATCTGTGTATTTGG + Intronic
1150835195 17:68557502-68557524 GAAGACAGCATCTGTGAACCGGG + Intronic
1152094950 17:78267424-78267446 GAAGAGAGAGTCTGTGGGGTGGG + Intergenic
1152819966 17:82432514-82432536 GAACAGAGACTCTGTGGCCTCGG - Intronic
1153088507 18:1317624-1317646 GGAGAGAGAATCTGTGAGATAGG + Intergenic
1153975019 18:10261620-10261642 GCAGTGACAATCTGTTCACTTGG + Intergenic
1154098028 18:11438782-11438804 GAAGAGACAATCTGTAGAATGGG + Intergenic
1154230457 18:12551952-12551974 GCAGAGAGAATCTGTGTGCTTGG + Intronic
1154407379 18:14106773-14106795 GTAGATAGAAGCTGTACACTTGG + Intronic
1155767342 18:29652343-29652365 GCATGGAGAATCTGTGCATTTGG + Intergenic
1156094152 18:33509585-33509607 ACAGAGAGAAACTGTGAACTTGG + Intergenic
1156328560 18:36097683-36097705 GAAAAGAGAAACTATGAACTGGG - Intergenic
1156615294 18:38776152-38776174 GAACAGTGAAACAGTGCACTTGG - Intergenic
1156633257 18:38995753-38995775 GAAAAGAGAATCTGAGCAGCAGG - Intergenic
1157022746 18:43806105-43806127 AGAGAGAGAATCTGGGTACTTGG - Intergenic
1157082365 18:44539635-44539657 GAATAGAGGTTCTGTGCAGTTGG - Intergenic
1157203595 18:45679820-45679842 GAAAAGAGATTCAGTTCACTGGG - Intronic
1157398316 18:47363018-47363040 GAAGAGACAATGTGTGGAATGGG - Intergenic
1157902385 18:51531911-51531933 GGGGAGAGAATCTGTAGACTAGG - Intergenic
1158007161 18:52685850-52685872 GAAGAGATAAGATATGCACTTGG + Intronic
1158468381 18:57712314-57712336 GGAGAGAAAATCTGTACGCTTGG + Intronic
1158906086 18:62013183-62013205 GAAGAGGGATGCTGGGCACTTGG - Intergenic
1159092144 18:63861313-63861335 CAGGAGAGACTCTGTGCTCTTGG - Intergenic
1159224915 18:65521920-65521942 GGAGAAAGAATCTGTGCACTTGG + Intergenic
1160123573 18:76151157-76151179 GAGGAGAGATCCTGTGCAGTGGG + Intergenic
1164916028 19:32053004-32053026 GATGAGAGAAGCTGGGCAGTTGG + Intergenic
1165573177 19:36792296-36792318 GGTAAGGGAATCTGTGCACTTGG + Intergenic
1166757721 19:45203796-45203818 GGAGAGAGAATCTGTGCATTTGG - Intronic
1167595829 19:50427701-50427723 GATGAAAGAATCTGTGAAATGGG - Intronic
1167876551 19:52418769-52418791 AAAGAGAGAATGTGTGCCATGGG - Intergenic
924993869 2:339803-339825 GAAGAGAGACGTTGTGGACTTGG - Intergenic
925484844 2:4316552-4316574 GAAGAGAGAATCTGTACACTTGG - Intergenic
925506443 2:4569916-4569938 AGAGAGAGAATCTGAGAACTAGG - Intergenic
925588465 2:5486916-5486938 GGAGAGAGAATCTGTAAGCTTGG + Intergenic
925660393 2:6196304-6196326 GGAGAGAGGATCTTGGCACTGGG + Intergenic
925977573 2:9151751-9151773 GAAGAGATGATATGTTCACTTGG - Intergenic
927068507 2:19498805-19498827 GAAGTGAGCATCTGTGTAATTGG - Intergenic
928483949 2:31710966-31710988 AGAGAGAGAATCTGTGTGCTTGG + Intergenic
928715656 2:34056722-34056744 TGAGACAGAATCTGTGCCCTTGG - Intergenic
928846271 2:35676881-35676903 AGAGGGGGAATCTGTGCACTTGG - Intergenic
930041355 2:47127568-47127590 GAAGAAAGAATTTGTGAGCTTGG - Intronic
930355525 2:50313860-50313882 GCAGACAGAATCTGGGCACAGGG + Intronic
930439792 2:51391245-51391267 GGAGACAGAATCTGGGCACTTGG - Intergenic
930592797 2:53349288-53349310 AAAGAAAGCATCTGTACACTAGG - Intergenic
930727226 2:54694205-54694227 AGAGAGAGAATCTGTGCACTTGG + Intergenic
930971405 2:57398825-57398847 ACAGAGAGAGACTGTGCACTTGG - Intergenic
931407017 2:61988971-61988993 GTAGAGAGAATCTGTGTGTTTGG - Intronic
931582896 2:63796532-63796554 AAAGAGATAATCTGTGTGCTTGG + Intronic
933086608 2:78061218-78061240 GGAGAGAGAATCTGTGTCCTGGG + Intergenic
933242025 2:79932356-79932378 GAAGAGGGAACCAGTGAACTTGG + Intronic
933341746 2:81034447-81034469 GAGGAGAGAATCTTTGTACTTGG - Intergenic
934727723 2:96635424-96635446 AAAGTGAGATTCTGTGGACTTGG - Intronic
934870510 2:97860963-97860985 AGAGAGAGAGTCTGTGCACTTGG + Intronic
935835679 2:107050656-107050678 GGAGAGAAAATCTCTGCACTTGG - Intergenic
936096714 2:109535867-109535889 GAGAAGAGAGTCTTTGCACTGGG + Intergenic
936925228 2:117730304-117730326 GCAAAGAGAGTCTGTGCTCTTGG + Intergenic
937464346 2:122117618-122117640 GAAGAGACAATCTGTTGAATGGG - Intergenic
937980585 2:127612333-127612355 GAGCAGAGATTCTGTGCTCTGGG - Intronic
938987547 2:136593258-136593280 GAAGAGAGACTCAATGCTCTGGG - Intergenic
939143432 2:138382560-138382582 GAAGAGTCAATCTGTGGAGTGGG + Intergenic
939425663 2:142032976-142032998 GAAGAGAGAACCTGGGCAAGTGG - Intronic
939724922 2:145706439-145706461 GAAGAGAAAATATATGCAGTAGG - Intergenic
939923603 2:148146846-148146868 GAAGAAAGAATCAGTGAACTTGG - Intronic
939987746 2:148848534-148848556 GAAGAAAGAATCAGTACATTTGG - Intergenic
940546798 2:155099720-155099742 CAAGAGAGAGCCTATGCACTTGG + Intergenic
941357378 2:164510923-164510945 GGAGAAAGAATCTGTGTACTTGG + Intronic
941405624 2:165084016-165084038 GAAGACAGTATCTATGCAATAGG - Intergenic
941471136 2:165888440-165888462 GAAGCAAGAATCTGTGCAACTGG - Exonic
942690778 2:178582609-178582631 GAAGAGTGAATATGTGGAATGGG + Intronic
942803104 2:179898670-179898692 GGAGAGAGAATATGTGAAGTGGG - Intergenic
943067740 2:183106279-183106301 CAAGAGAGAATGTGTGTGCTTGG - Intergenic
943372395 2:187030984-187031006 GAAGAGACAATCTGTCAAATGGG + Intergenic
943676817 2:190723846-190723868 GAAGACAGAATCAGGGCCCTGGG - Intergenic
943867051 2:192938517-192938539 GGAGAAAGAATCTGTGCACTTGG - Intergenic
944365953 2:198919841-198919863 GGAGAGAGAACCTGTGCTTTTGG - Intergenic
944550152 2:200838305-200838327 GGAGAGATAATCTGTGAACTTGG + Intergenic
944772694 2:202930463-202930485 GCAGAGAGAATTTCTGAACTTGG - Intronic
945334317 2:208573465-208573487 GAAGAGAGAATCTGTGTGCTTGG + Intronic
947094076 2:226546088-226546110 CAAGAGAGAATTTGTGCAGGGGG + Intergenic
947131037 2:226924833-226924855 AGACAGAGAATCTGTGTACTTGG - Intronic
947187577 2:227468924-227468946 GATGAGACAATGTGAGCACTGGG + Intergenic
947940782 2:234053436-234053458 GAGTAGAGAATCACTGCACTTGG - Intronic
947999535 2:234556320-234556342 GGAGTGAGGCTCTGTGCACTGGG - Intergenic
948475623 2:238217142-238217164 GGAGAGACAATCTGTGCCCTTGG - Intergenic
1169623816 20:7540174-7540196 GGAGAGAGAATCTGTGTGCCTGG + Intergenic
1169917535 20:10698477-10698499 GAAGAGAAAATCAGGACACTGGG + Intergenic
1171176755 20:23056907-23056929 GAAGACAGATCCTGTGCACATGG + Intergenic
1171482981 20:25468140-25468162 GAAGGGAGAATGTGTGTTCTGGG - Intronic
1172783624 20:37451711-37451733 GAAGAGAGAAACTGCCCAATGGG - Intergenic
1173044105 20:39492960-39492982 GAAGAGACAATCTATGAACCAGG + Intergenic
1174292951 20:49521884-49521906 GAAGACAGAGTCAGTGGACTTGG - Intronic
1174690926 20:52503787-52503809 GGAGAGAGCATCTGTGCACTTGG + Intergenic
1176197183 20:63842745-63842767 GACGGCAGAATCTGTGCTCTGGG + Intergenic
1177137206 21:17318223-17318245 ATAGAAAGAATTTGTGCACTTGG + Intergenic
1177740732 21:25149521-25149543 GCAGACAGAATCTGTGCACTCGG - Intergenic
1177771186 21:25518539-25518561 GGAGAAAGAATCTGTGTGCTTGG + Intergenic
1177969903 21:27777033-27777055 GCACAGAGAATCTGTGCACTTGG + Intergenic
1178070065 21:28954986-28955008 GAAGAGACAATCTGTAGAATGGG + Intronic
1178723364 21:35029674-35029696 TAAGAGAGAAGCTAAGCACTAGG - Intronic
1178993532 21:37376050-37376072 GAAGAGAGAGTCTGAGTGCTGGG + Intronic
1179946337 21:44680091-44680113 GAAGAGACAACCTGTGTAATGGG + Intronic
1181504000 22:23338523-23338545 GAAGGGAAAATCTATGCACAGGG - Intergenic
1181654841 22:24288057-24288079 GAAGGGAAAATCTATGCACAGGG - Intronic
1181708995 22:24668742-24668764 GAAGGGAAAATCTATGCACAGGG - Intergenic
1181901555 22:26160356-26160378 GAACAGAAAAGCAGTGCACTAGG + Intergenic
949329834 3:2909242-2909264 GAAGAGGGGAGCTGTGCACTTGG + Intronic
949623103 3:5838041-5838063 GGAGAGAGAATCTGTGTGCTTGG - Intergenic
950332971 3:12171374-12171396 TGAGAGAGAATCTGTGAACCAGG + Intronic
950642502 3:14357638-14357660 GAAAATAGAATCTGAGAACTTGG + Intergenic
951125966 3:18983410-18983432 GAAGAGAGAATCTGTATGCTTGG - Intergenic
951255043 3:20439024-20439046 AGAGAGAGAATCTGTTCATTTGG + Intergenic
951310374 3:21117829-21117851 GCATGAAGAATCTGTGCACTTGG - Intergenic
951393081 3:22130637-22130659 GAAGAGAGAATCTGTGCTCTTGG - Intronic
951398608 3:22202723-22202745 GGACAGAGAATCTGTGAGCTTGG + Intronic
951437102 3:22677214-22677236 GGAGAGAGAATCTGTGTGCTTGG - Intergenic
951492579 3:23288888-23288910 GAAGAGAGAATATGTATTCTTGG - Intronic
951495172 3:23317414-23317436 GGAGAGACAATCTGTGCACTTGG - Intronic
952518015 3:34125163-34125185 AGAGAAAGAATCTGTGCACTTGG - Intergenic
952897984 3:38091573-38091595 GAAGAGACAATCTGTGAAATGGG + Intronic
953513079 3:43563020-43563042 GAAGAGACAATCTGTTGAATGGG + Intronic
953824381 3:46237372-46237394 GAAGAGACAATCTGTAGAATGGG - Intronic
954491485 3:50910735-50910757 GGAGAGACAATCTGTGTACTTGG - Intronic
954546646 3:51441803-51441825 GAAGAGAGCTTCCGTGGACTGGG + Exonic
955274498 3:57534191-57534213 GGAGAGAGAATCTGTGCACTTGG - Intronic
955286895 3:57650526-57650548 GAAGACAAGATCTGGGCACTTGG - Intronic
955389891 3:58514087-58514109 AAATAGAGGATCTGTGGACTAGG - Intronic
955725699 3:61930445-61930467 GAAGTGATAATCTGTGTGCTGGG - Intronic
956375637 3:68610599-68610621 GAAGAGACAACCTGTGGATTGGG - Intergenic
956648587 3:71481910-71481932 GAAGAGTGAATTTGTGGAGTGGG - Intronic
957058209 3:75460415-75460437 GAAAATAGAATGTTTGCACTGGG - Intergenic
957211684 3:77267212-77267234 GTAGAGAGAACCTTTGAACTTGG - Intronic
957976233 3:87448215-87448237 GGAGAGATAATCTGAGTACTTGG - Intergenic
958765993 3:98368361-98368383 GGAGAGACAATCTGTGTGCTTGG - Intergenic
959110761 3:102119706-102119728 GAAGAGACAACCTATGCAATGGG - Intronic
959118609 3:102206914-102206936 GAAGAAAGAATCTGTGCATTTGG - Intronic
959147077 3:102560509-102560531 GAAGAGACATTCTGTGCTCATGG - Intergenic
959189962 3:103098210-103098232 GGAGAGAGAATCTGTGCATTTGG - Intergenic
959235867 3:103720938-103720960 GAAGAAAGAAGCTATGAACTAGG - Intergenic
959474235 3:106790150-106790172 GTGCAGAGAATCTGTGCAATTGG + Intergenic
959737427 3:109676000-109676022 GAATAGAGAATCTAGGCAGTTGG - Intergenic
959774243 3:110137118-110137140 GAAGAAAGAATTTGTGAACTTGG + Intergenic
960067196 3:113386857-113386879 GAAGAGATAATCTGGGTACTTGG + Intronic
960354059 3:116629270-116629292 GTAGAGAGAATCTGTATGCTTGG - Intronic
960397319 3:117153316-117153338 GAAGAGAAAATCTGGGCAGGGGG - Intergenic
960564807 3:119122219-119122241 GCATGGAAAATCTGTGCACTTGG + Intronic
960598285 3:119428376-119428398 GAAGAAAGAATCAGTGTGCTGGG - Intergenic
961083934 3:124050367-124050389 GAAGACAGAACCTCTGCACTTGG + Intergenic
961104347 3:124228340-124228362 AACTGGAGAATCTGTGCACTTGG + Intronic
961610294 3:128132067-128132089 AGAGAGAGAATCTATGTACTTGG + Intronic
962015037 3:131430922-131430944 GAGGGGAAAATCTGTGTACTCGG + Intergenic
962149787 3:132880656-132880678 GAAGAGCAAAGCTGTGCCCTTGG - Intergenic
962390096 3:134964147-134964169 GAAGGGAGAGTCTTTGCATTAGG + Intronic
962442202 3:135430797-135430819 GAAGAAAGAATCTCAGAACTTGG + Intergenic
962468177 3:135679848-135679870 TAACAGCCAATCTGTGCACTGGG + Intergenic
962690245 3:137889085-137889107 GAAATGAGTATTTGTGCACTTGG - Intergenic
963154015 3:142077017-142077039 AAAGAGAGAATCTATGCACCTGG + Intronic
963358227 3:144237434-144237456 GAAGTGAGAATCTGTGTATGTGG - Intergenic
963643517 3:147885114-147885136 GAAGAGAAAGTCTTTGCTCTTGG + Intergenic
963701276 3:148629960-148629982 GGAGAGAGAATCTGTGTGCTTGG + Intergenic
964021671 3:152021050-152021072 ACAGAGAGAATCTGTGCACTTGG + Intergenic
964259042 3:154812417-154812439 TGGAAGAGAATCTGTGCACTTGG - Intergenic
964349684 3:155790635-155790657 GGAGGGAGAATCTATGCACTTGG + Intronic
964583015 3:158260892-158260914 AGAGACAGAATCTGTGCACTTGG - Intronic
964934054 3:162059778-162059800 GCACAGAGAATCTGGGCCCTGGG + Intergenic
964965158 3:162482692-162482714 AGAGAGAGATTCTGTGCACCTGG - Intergenic
964992179 3:162827970-162827992 AAAGAGAGAATCTGTGCCCTTGG + Intergenic
965034579 3:163422524-163422546 AGAGAGATAATCTGTGTACTGGG + Intergenic
965175347 3:165323217-165323239 GGAGAGAGAATCTGTGGACTTGG - Intergenic
965253050 3:166368015-166368037 AGAGAGAGAATTTGTGCACTTGG + Intergenic
965256978 3:166425725-166425747 GGAAAGAGAATCTATGCACTTGG + Intergenic
965358595 3:167709405-167709427 GGACAAAGAATATGTGCACTTGG + Intronic
965379136 3:167966749-167966771 GGAGAGAGAATCTGTGTGCTTGG + Intergenic
965415307 3:168385187-168385209 ACAGAGAGAGTCTGTGCTCTTGG - Intergenic
965843051 3:172929638-172929660 GAAGAGAGTATCAGTGAGCTGGG - Intronic
965980182 3:174681005-174681027 GGAGAGAGAATCTGTGTGCTTGG + Intronic
966091557 3:176144404-176144426 GAACAGAAAATCTGAGAACTAGG - Intergenic
966141823 3:176766273-176766295 GGAGAGAGAATCTGTGTGCTTGG + Intergenic
966454113 3:180095083-180095105 AGAGAGAGAATCTGTACACAGGG - Intergenic
966476810 3:180358219-180358241 AAAGAAAGAAAATGTGCACTGGG + Intergenic
966960785 3:184936680-184936702 GAAGGGAGGATCTGTGGATTAGG - Intronic
967454472 3:189667482-189667504 GGAGGTAGAATCTGTGGACTAGG + Intronic
967608827 3:191481028-191481050 AGAGAAAGAATCTGTGCACTTGG + Intergenic
967779595 3:193420811-193420833 GAAGAAAGAATCTCTGAATTTGG + Intronic
967801654 3:193668626-193668648 GAGGAGAGTATCTGTGCAGGAGG - Intronic
967983600 3:195079803-195079825 AAAGAGAGAATCTGTTTACAAGG + Intronic
968096037 3:195931490-195931512 GGAGAGAGAATCCGTGAGCTGGG + Intergenic
968096047 3:195931552-195931574 GGAGAGAGAATCCGTGTGCTGGG + Intergenic
968096058 3:195931614-195931636 GGAGAGAGAATCCGTGTGCTGGG + Intergenic
968096069 3:195931676-195931698 GGAGAGAGAATCCGTGTGCTGGG + Intergenic
968096080 3:195931738-195931760 GGAGAGAGAATCCGTGAGCTGGG + Intergenic
968646697 4:1744651-1744673 GGAGGGAGAATCTGAGCACCTGG + Intronic
970034400 4:11716084-11716106 GGAGAGAGAATCTATTCACCTGG - Intergenic
970098081 4:12487473-12487495 AAAGAGAGAAACTGTGCATTTGG - Intergenic
970820462 4:20205811-20205833 GAAGTGAGAATATGGCCACTGGG + Intergenic
971703013 4:30005196-30005218 GAAGAGATAAACTGTTCAATGGG - Intergenic
973169470 4:47121291-47121313 GGAGAGAGAATCTATGTGCTTGG - Intronic
974224365 4:59019253-59019275 ACAGAGAGAATCTGTGTGCTTGG - Intergenic
974290612 4:59925437-59925459 GCAGAGAGAATCTATGCCTTTGG + Intergenic
974747370 4:66092948-66092970 GAAGAGAGATTCTTTGCTATTGG - Intergenic
975040126 4:69736020-69736042 ATGGTGAGAATCTGTGCACTTGG + Intronic
975317770 4:72974910-72974932 GCAGAGAAAAGCTGTGCAGTGGG + Intergenic
975369601 4:73569075-73569097 GTGTGGAGAATCTGTGCACTTGG - Intergenic
975503788 4:75116546-75116568 GCAGAGACAATGTGAGCACTTGG + Intergenic
976227294 4:82805627-82805649 GAAGAGAAAATCTGTTTATTAGG + Intergenic
976728617 4:88240720-88240742 AGAGAGAGAATCTGTGCACTTGG - Intergenic
976908185 4:90266640-90266662 GGAGAGAGAATCTGTGCTTCTGG + Intronic
976997537 4:91454277-91454299 GAGGAGAGAATCAGTTCCCTTGG + Intronic
977307326 4:95341827-95341849 GGAGAGAGAATCTGTGTCCTTGG + Intronic
977325809 4:95573108-95573130 GCACAGAGAACCTGTACACTTGG - Intergenic
977381124 4:96274876-96274898 GCACAGAGAATCTGTGTGCTTGG - Intergenic
978008776 4:103652403-103652425 GGAGAGAGAATCTTTGCCCTTGG - Intronic
978111162 4:104965187-104965209 GAAGAGACAATCAGTGAAATAGG - Intergenic
978112953 4:104984875-104984897 GGAGAGAGAATGTGTGCAGGAGG + Intergenic
978733679 4:112061300-112061322 AGAGAGAGAATCTGTGCATTTGG + Intergenic
978830094 4:113073411-113073433 GAATAGAGAATAGATGCACTGGG + Intronic
979172395 4:117618152-117618174 GAAGAGACAATCTATGGAATGGG + Intergenic
979492241 4:121341422-121341444 GAAGAGAGAATTTCTGCTTTTGG - Intronic
979945719 4:126829509-126829531 ACAGAGAGAATCTGTGTGCTTGG + Intergenic
980093265 4:128464000-128464022 GAACTGAGAATCAATGCACTGGG + Intergenic
980442421 4:132866696-132866718 GCACAGAGAATCTGTGCACTTGG + Intergenic
980596821 4:134965892-134965914 AGAGAGAGAATCTGTGTGCTTGG + Intergenic
980682797 4:136186528-136186550 GGAGAAAGAATCTCTGTACTTGG + Intergenic
980752905 4:137115726-137115748 GGAGGGAGAATCTGTGTTCTTGG + Intergenic
981045312 4:140259400-140259422 GAAGAGAAAATATGTGCAGTAGG - Intronic
981286398 4:143024157-143024179 AGAGAGAGAGTCTGTGCAATTGG + Intergenic
982111209 4:152056565-152056587 GAAGAGACAATCTATGGATTGGG - Intergenic
982190853 4:152854211-152854233 GAAGAAAGAATCTCAGAACTTGG - Intronic
982339717 4:154284563-154284585 AGAGAGAGAATCTGTGCACTTGG + Intronic
982521034 4:156416869-156416891 GCAGAGAGCATTTGAGCACTGGG + Intergenic
982525003 4:156466996-156467018 GGAGAGAAAATTTGTGCACTCGG + Intergenic
982719635 4:158846955-158846977 AGAAAGGGAATCTGTGCACTTGG + Intronic
982828410 4:160028300-160028322 TGGGAGAGAGTCTGTGCACTTGG - Intergenic
983493000 4:168411390-168411412 GCAGAGAGAGTCTGTGCACTTGG + Intronic
984860383 4:184232421-184232443 GGAGAGAGACTCTGAGTACTCGG - Intergenic
984915477 4:184719319-184719341 GCACAGAGAATCTGTGCTCTTGG + Intronic
986631311 5:9776272-9776294 GGAGAGAGAATCCATGCACTTGG - Intergenic
987088287 5:14488787-14488809 GGGGAAAGAATCTGTCCACTGGG + Intronic
987675692 5:21070231-21070253 CAAGAGGGGATCTGTTCACTTGG - Intergenic
987886177 5:23815878-23815900 GGGGAGAGAATCTGTGTGCTTGG + Intergenic
988064577 5:26218324-26218346 AGAGAGAGAATCTGTGTGCTGGG + Intergenic
988143483 5:27273571-27273593 AAGGAAAGAATCTGTGAACTTGG - Intergenic
988265435 5:28942692-28942714 GGAGAGAAAATCTGTGTCCTTGG - Intergenic
988340024 5:29959463-29959485 AAAGAGAGAATCTGTCAACTTGG + Intergenic
989515977 5:42343903-42343925 GAAGAGATAACCTGTCCAATGGG + Intergenic
989657820 5:43762896-43762918 ACATAGAGAATCTGTGCACTTGG - Intergenic
989956457 5:50366760-50366782 GAAGAAAGAATTAGTGAACTGGG + Intergenic
989963470 5:50441721-50441743 GAAGAGAGAATGTGTGTGATTGG - Intronic
990202970 5:53398337-53398359 GCATGGAGAATCTGTGCGCTTGG - Intergenic
991207778 5:64069299-64069321 CAAGAGAGGATCTGTTCACTTGG - Intergenic
991977853 5:72200228-72200250 GAAGAAAGAATCTGTGGAAAAGG + Exonic
992460452 5:76954664-76954686 GAAGACAGCCTCTGTGCTCTCGG - Intronic
992579327 5:78155268-78155290 GCATGGAGAATCTCTGCACTAGG - Intronic
993171141 5:84420208-84420230 AGAGAGATAATCTGTGCACTTGG - Intergenic
993256974 5:85604445-85604467 GGAGAGAGAATCTGTGTCCTTGG + Intergenic
993331110 5:86601298-86601320 AAAGAGACAATCTGTTGACTTGG + Intergenic
993932322 5:93954983-93955005 GGAGAGAGAATCTGTGCATTTGG - Intronic
994028469 5:95113449-95113471 GGAGAGAGAATCTGTGCACTTGG + Intronic
994343673 5:98661398-98661420 GCACAGAGAATCTGTGTACTGGG + Intergenic
994530473 5:100963597-100963619 GAAGAGAGAATCTATAGAATAGG + Intergenic
995081950 5:108061414-108061436 GAAGAGAGAAAATGAGCACAAGG + Intronic
995527773 5:113064301-113064323 GAAGAGAAGATCTGTGTTCTGGG + Intronic
995573290 5:113503662-113503684 GGAGAGAGAATCTGTGTATTTGG - Intergenic
995617506 5:113982121-113982143 GAAGAGACAATCTGTTAAATAGG - Intergenic
995770500 5:115664527-115664549 GGAGAGAGGATCTGTGGGCTTGG + Intergenic
996193599 5:120576209-120576231 GAAGAGATAAACTATGGACTGGG + Intronic
996210029 5:120797774-120797796 ACAGAGAGAATCTGTGCCATTGG + Intergenic
996906695 5:128608998-128609020 AGAGAGAGAATCTGTGTGCTTGG - Intronic
996931746 5:128896987-128897009 GCACAGAGAATCTGAGTACTTGG - Intronic
997104504 5:131003898-131003920 CAAGAGAGAATCTGTGTGCTTGG + Intergenic
997186093 5:131883834-131883856 GTAGACAGAATCTGTGCATTTGG + Intronic
997206820 5:132054980-132055002 GAAAAGAGTATCAGTCCACTGGG - Intergenic
997616781 5:135252003-135252025 GAAGGGAGCATCTCTGCACAGGG - Intronic
998501742 5:142638732-142638754 GAAGAGAAAACCTATGCAATGGG + Intronic
998689755 5:144574559-144574581 GGAGAGAGATACTGTTCACTTGG + Intergenic
998853175 5:146370173-146370195 GAAGAGAGTACATGTGAACTTGG + Intergenic
998960096 5:147477282-147477304 GAAGAGAGAATTTGTGAGCCAGG + Intronic
999662084 5:153874860-153874882 GAAAATAGAGTCTGGGCACTGGG + Intergenic
999667305 5:153926726-153926748 GGAGAGAGAATCCATGCACTTGG + Intergenic
999849605 5:155523926-155523948 GGAGAGAGAACCTGTGTGCTTGG - Intergenic
1000433404 5:161179284-161179306 GGAGAGAGAATCTATGCTGTTGG + Intergenic
1000695936 5:164383815-164383837 GAAGAAAGGATGTGTGAACTTGG - Intergenic
1001359577 5:171068118-171068140 GAAGAAAGAATCAGTGAACTTGG - Intronic
1001845248 5:174916419-174916441 TCAGAGAGAATCTACGCACTTGG + Intergenic
1002009879 5:176270643-176270665 GGAGAGAGAATCTGTGTGCTTGG + Intronic
1002216847 5:177641665-177641687 GGAGAGAGAATCTGTGTGCTTGG - Intergenic
1002695743 5:181087207-181087229 GAAGGGAGAGTCTGTTCCCTGGG - Intergenic
1004356881 6:14937427-14937449 GAAGAGACAATCTGTAGAATGGG - Intergenic
1006736083 6:36273513-36273535 GGAGAGAGAATCCCTGCACCAGG - Intronic
1006795244 6:36728173-36728195 GAAGAGGGGAGCTGAGCACTGGG + Intronic
1007001777 6:38320106-38320128 GGAGAGAGAATCCGTGCATTTGG - Intronic
1007021738 6:38528090-38528112 AAAGAGAGAATCTGTGCACTTGG + Intronic
1008289361 6:49694568-49694590 GGAGAGAGACACTGTCCACTTGG - Intronic
1008707667 6:54182344-54182366 GCACAGAGAGTCTGTGCACTTGG - Intronic
1009039467 6:58159128-58159150 GGAGACAAAATCTGTGCATTTGG - Intergenic
1009215359 6:60913968-60913990 GGAGACAAAATCTGTGCATTTGG - Intergenic
1009473097 6:64052805-64052827 GAAGAGAGAATGAGTGCAAGTGG - Intronic
1009858546 6:69294655-69294677 GAAGATAAAATCCGTGCAGTGGG + Intronic
1011183668 6:84650404-84650426 GAAGACACCATCTGTGAACTAGG - Intergenic
1011386406 6:86802746-86802768 AGAGAGAGAATCTGTGCACTTGG - Intergenic
1011446856 6:87450862-87450884 AGATAGAGAATCTGTGTACTTGG + Intronic
1011508352 6:88072686-88072708 GAAGAGAGAAGGTGAGCTCTGGG - Intergenic
1011807127 6:91084706-91084728 CAAGAGAGAATTTGTGAACTTGG + Intergenic
1012028511 6:94028943-94028965 CAAGAGAGAATCTGTGCACTTGG + Intergenic
1012057119 6:94427178-94427200 ACAGAGAGAATCTGTGTGCTTGG - Intergenic
1012058460 6:94446237-94446259 GAAGAAAGAATCTGTGGTCTTGG + Intergenic
1012892000 6:104907551-104907573 GAAGAGAGAATCCGTGCGTTTGG + Intergenic
1013684773 6:112566523-112566545 GAAAAGGGAATCTGAGCAGTGGG - Intergenic
1013767481 6:113591864-113591886 AAAGACAGAATCTGTGTATTTGG + Intergenic
1014234510 6:118939566-118939588 GGAGAGAGAATCTGTGCACTTGG + Intergenic
1014378643 6:120711092-120711114 GAAGAGAGAATCTAAGGCCTTGG + Intergenic
1014378646 6:120711131-120711153 GAAGAGAGAATCTGTGCACTTGG + Intergenic
1015392780 6:132701822-132701844 GGAGAGAAAATTTGTGCCCTTGG + Intronic
1015460589 6:133487060-133487082 AGAGAGAGAATCTGTGCACTTGG + Intronic
1015501533 6:133938946-133938968 GAAAAGAGAATTGGTGAACTAGG - Intergenic
1015909328 6:138152076-138152098 GAAGAGACAACCTGTGGAATGGG - Intergenic
1016194515 6:141317526-141317548 AGAGAGAGAATCTGTGCCCTTGG + Intergenic
1016228580 6:141772728-141772750 GCATGGAGAATTTGTGCACTTGG - Intergenic
1016405825 6:143729046-143729068 GAAGAGACAATCTGTGGAATGGG + Intronic
1016541371 6:145169942-145169964 AGAGAGAGAATCTGTGTGCTTGG + Intergenic
1017035129 6:150260374-150260396 GAATAGAGCATCTGTCCCCTAGG + Intergenic
1018602007 6:165554216-165554238 GAAGAGACAATCCATGGACTGGG + Intronic
1018696308 6:166394184-166394206 TCAGAGAGAATCTGTGTGCTTGG + Intergenic
1019001653 6:168758539-168758561 CAAAAGAGAGTCTGTTCACTTGG - Intergenic
1019066297 6:169302180-169302202 GGAGAGACAATCTGTGTGCTTGG + Intergenic
1019913423 7:4115623-4115645 CAAGAGCGATTCTGTGCCCTGGG - Intronic
1021922974 7:25505687-25505709 AGAGAAAGAATCTGTGCACTTGG + Intergenic
1022158426 7:27683367-27683389 GAAGACAGTATCTGTGAACCGGG - Intergenic
1023811352 7:43914700-43914722 GAGAAAAGAATCTGTGAACTTGG - Intronic
1024087234 7:45903832-45903854 GAAGAAAGAATTAGTGAACTTGG + Intergenic
1024170174 7:46777291-46777313 GGAGAGAGAATATGTCCACTTGG + Intergenic
1024369230 7:48560349-48560371 GGAGAGGGAATCTGTGCACTTGG - Intronic
1024369306 7:48561671-48561693 GAAGAGACAATCTATGGATTGGG - Intronic
1024810043 7:53199410-53199432 AATGAAAGAATATGTGCACTAGG - Intergenic
1024959979 7:54963887-54963909 TAAGAGAGAATTTGTGCTCTTGG + Intergenic
1024994863 7:55266031-55266053 GAAGAGACAACCTGTGAAATGGG + Intergenic
1025297596 7:57788789-57788811 GGCAAGGGAATCTGTGCACTTGG - Intergenic
1026582559 7:71630407-71630429 GAGGAGGGGATCAGTGCACTGGG - Intronic
1026598952 7:71757573-71757595 GAAGAGACAACCTGTGGATTGGG - Intergenic
1027258206 7:76444769-76444791 AATGGGAGAATCTGTGCCCTGGG + Intergenic
1027280642 7:76607250-76607272 AATGGGAGAATCTGTGCCCTGGG - Intergenic
1027921280 7:84399100-84399122 GAAAAGAGAATCTGTGTGCTTGG + Intronic
1028247993 7:88505736-88505758 GGAGAGAAAATCTGTGTATTTGG - Intergenic
1028299665 7:89181522-89181544 GAAGAAATAATCTGTGTGCTTGG - Intronic
1028353525 7:89879040-89879062 GGAGAGAGAATCTGTGTGCTTGG - Intergenic
1028853430 7:95562992-95563014 GAAGAGAAAACCTATGCAATGGG + Intergenic
1028868186 7:95737118-95737140 GGAGAGAAAATTTGTGCCCTTGG - Intergenic
1028901285 7:96102989-96103011 TAAGATAGAAACTGTGCATTGGG + Intronic
1029593233 7:101521122-101521144 GGAGAGAGAATGTGTGCAGGGGG + Intronic
1030054669 7:105573088-105573110 GAAGAGACAACCTATGCAATGGG - Intronic
1030868171 7:114725126-114725148 GAAGAGAGAAGCTGTTGAATGGG - Intergenic
1030966185 7:115995750-115995772 GGAGAGAGTATCTGTGCTCTTGG + Intronic
1031306143 7:120130294-120130316 GGAGAGAAAATCTGTGCACTTGG + Intergenic
1031775579 7:125905073-125905095 AGAAAGATAATCTGTGCACTTGG - Intergenic
1031862189 7:126993648-126993670 AGAAAGAGAATCTGTACACTTGG + Intronic
1032942344 7:136809757-136809779 AGAGAGAGAATCTGTGCACTTGG + Intergenic
1033542479 7:142369631-142369653 GGAGAGACAGTCTGTGCATTTGG - Intergenic
1033628613 7:143135161-143135183 GAAGAGAGAATCAGAACACCAGG - Intronic
1033867905 7:145714717-145714739 AGAGAGACAATCTGTGCTCTTGG - Intergenic
1035138971 7:156738149-156738171 GGAGAGAGAATCTGTGTACTTGG + Intronic
1035486503 7:159230474-159230496 GAGGTGAGGATCTGTGCACTTGG + Intergenic
1036687306 8:10920537-10920559 GCAGAGAAAATGTGTGGACTTGG - Intronic
1036814938 8:11895041-11895063 GAAGAGAGAATCTGTGTGCTTGG - Intergenic
1036936088 8:13003972-13003994 GCAGAGAGAATCTGTGCTTAGGG + Intronic
1036952015 8:13149684-13149706 GCAAAGAGAACCTGTGTACTTGG + Intronic
1037369102 8:18154497-18154519 GAAGAGACAATCTGTAGAATGGG + Intergenic
1037518465 8:19657159-19657181 GAAGAGACAATTTGTGCACTTGG + Intronic
1038946555 8:32367614-32367636 GAAGAGACAATCTGAGGAATGGG - Intronic
1039158546 8:34590808-34590830 GAAGAGACAATCTATGGAATGGG - Intergenic
1039644749 8:39268672-39268694 TAGGAGAAAATCTGTGAACTTGG - Intronic
1039652558 8:39358088-39358110 AAAGAAAGAATCTGTGAAATAGG + Intergenic
1039897654 8:41727624-41727646 GGAGAGAGAAACTGAGGACTGGG - Intronic
1040485609 8:47868842-47868864 GGACACAGAAGCTGTGCACTTGG + Intronic
1040613260 8:49008158-49008180 GAGGAGAGAACCAGTGCATTTGG - Intergenic
1040743243 8:50605569-50605591 GAAGAGAGAATCTGTGCACTTGG - Intronic
1040943018 8:52852375-52852397 GAGGAGACAATCTGGGCACAGGG + Intergenic
1041078953 8:54196468-54196490 GAAGAGACAATCTGTTGAATGGG - Intergenic
1041305387 8:56452221-56452243 GAGGAAAGAATCTCTGGACTTGG + Intergenic
1041606819 8:59792009-59792031 GGAGAGAGAATCTGTCTGCTTGG + Intergenic
1041720021 8:60967387-60967409 GGAGAAAGAAGCTCTGCACTGGG + Intergenic
1041794491 8:61732159-61732181 GAAGATAGAGTATGTTCACTGGG - Intergenic
1042297819 8:67241881-67241903 AGAGAGAAAATCTGTGTACTTGG + Intronic
1042502828 8:69528064-69528086 GAAGATAGAGACTGTGCAGTTGG - Intronic
1042699085 8:71592062-71592084 GAAGAGACATTCTGTGTACTTGG - Intergenic
1043000004 8:74746619-74746641 GAAGAGAGAATATTTACATTTGG + Intronic
1043041965 8:75275196-75275218 GAAGAGAGAATCTGTGCACCTGG + Intergenic
1043156707 8:76791221-76791243 GAAGAGAGAATTTATGAAGTAGG - Intronic
1044809947 8:96049692-96049714 GAAGAGACAATCTGTTGAATGGG + Intergenic
1045041433 8:98228060-98228082 GCACAGAGAATCTGCACACTCGG - Intronic
1045172060 8:99682478-99682500 GAAAAGAGAAGCTATGTACTGGG - Intronic
1045433037 8:102131878-102131900 GAAGAGACAATCTATGGATTAGG - Intergenic
1046114261 8:109766036-109766058 GCAGAAAGAGTCTGTGCACCTGG - Intergenic
1046254518 8:111679083-111679105 GAAGAGGGAATCTATTCAGTTGG - Intergenic
1046463487 8:114571810-114571832 AAAGAGAGAATCTGTGCTTTTGG - Intergenic
1047001260 8:120575096-120575118 GAAGAGGGTATGTGTGAACTGGG + Exonic
1047138490 8:122107903-122107925 GGAGTGAGAATCTGTGCACCTGG - Intergenic
1047342936 8:124000202-124000224 GGAAAGAAAATCTGAGCACTTGG - Intronic
1047816833 8:128473827-128473849 GAGGAGGGCATCTGTGCAGTGGG - Intergenic
1047938094 8:129801188-129801210 ACAGAGAGAATCTGTGTGCTTGG - Intergenic
1048490271 8:134885574-134885596 GAAGACAGAGGCTGTGCAGTTGG + Intergenic
1050355643 9:4780565-4780587 GTGCAGAGAATCTGTGCATTTGG + Intergenic
1050930282 9:11313469-11313491 GAAGAGAGAATCTGAATACTTGG - Intergenic
1051047078 9:12888212-12888234 ACACAGAGAGTCTGTGCACTTGG + Intergenic
1051306612 9:15717155-15717177 GTGGGGGGAATCTGTGCACTTGG + Intronic
1051469711 9:17423834-17423856 CGAGAGAGAATCTGTGTGCTTGG - Intronic
1051842462 9:21414013-21414035 GCATGGAGAATCTGTGCACTTGG - Intronic
1051966756 9:22836987-22837009 GCATGGATAATCTGTGCACTTGG - Intergenic
1052093876 9:24361707-24361729 AGAGAGAGAATTTGTGCTCTTGG + Intergenic
1052119650 9:24696513-24696535 TAAGAGACAATCTATGAACTTGG + Intergenic
1052301834 9:26960945-26960967 GAATAGAGAAGCTGTGAACTAGG + Intronic
1052450607 9:28625310-28625332 GGAGAGAGAATCTGTGCACTTGG - Intronic
1053796015 9:41727252-41727274 GGCAAGGGAATCTGTGCACTTGG + Intergenic
1054149165 9:61587621-61587643 GGCAAGGGAATCTGTGCACTTGG - Intergenic
1054184421 9:61939323-61939345 GGCAAGGGAATCTGTGCACTTGG + Intergenic
1054468929 9:65518734-65518756 GGCAAGGGAATCTGTGCACTTGG - Intergenic
1054654084 9:67649172-67649194 GGCAAGGGAATCTGTGCACTTGG - Intergenic
1054835394 9:69671440-69671462 GAAGCGAGAATCCCTACACTGGG + Intronic
1054982457 9:71222731-71222753 GGAAAGAGAATCTGTGTGCTTGG + Intronic
1055227259 9:74014539-74014561 GGAGAGAGAATCTATGTACTTGG + Intergenic
1055300978 9:74882311-74882333 GAAGAGACAATCTGTTGAGTTGG + Intronic
1055580089 9:77699108-77699130 GCATGGAGAATCTGTGCACTTGG - Intergenic
1055826908 9:80338483-80338505 GGAGAGAGAATCTGTGTGCTTGG + Intergenic
1055904614 9:81278342-81278364 GAAGAGAGAAATTGTGGAATAGG - Intergenic
1056516662 9:87358773-87358795 ACAGAGAGAATCTGTGTGCTTGG + Intergenic
1056525285 9:87437802-87437824 GCAGAGTTAATCTGTGCATTTGG + Intergenic
1056802158 9:89699850-89699872 GAGGAGAGAAAGTGTGGACTTGG - Intergenic
1057084504 9:92196660-92196682 AAAGAGAGAATCTATGTTCTTGG + Intergenic
1057346698 9:94258124-94258146 GGAGAGAGAATCTATGTTCTTGG + Intergenic
1058086290 9:100752054-100752076 AGAGAGAGAATCTGTGCACTTGG - Intergenic
1058409192 9:104712057-104712079 GGAGAGGGAATATGTGAACTAGG + Intergenic
1058522924 9:105829468-105829490 AGAGACAGAATCTGTGAACTTGG - Intergenic
1058708749 9:107660120-107660142 GAAGACAGAATCAGTCCAATGGG + Intergenic
1059835754 9:118150229-118150251 GAACACAGAATCTGAGCAATGGG + Intergenic
1060223502 9:121776512-121776534 GAAGAGAGTGTCTGGGCAGTGGG + Intronic
1062026632 9:134343671-134343693 GAGGAGAGACCGTGTGCACTTGG + Intronic
1186602266 X:11050329-11050351 GGAAAGAGAATCTGTGCACTTGG - Intergenic
1187594953 X:20760682-20760704 AGAGAGAGAATCTGTGTACTTGG - Intergenic
1188087241 X:25914530-25914552 GGAAAAAGAATCTGTGAACTTGG + Intergenic
1188980418 X:36721981-36722003 GAAGAGAGAATCGCTGCCATTGG + Intergenic
1188992352 X:36837574-36837596 AGAGAGAGAATCTGTACACTTGG - Intergenic
1189194830 X:39144039-39144061 GAAGAGGGATTCTGTGGCCTGGG + Intergenic
1189412008 X:40780622-40780644 GAAGAAAGAATCTGTGGGCTTGG - Intergenic
1189628044 X:42920711-42920733 GAAGAGAAAATCTGTGTACTGGG + Intergenic
1189634541 X:42992146-42992168 CAAGAGAGGGTCTGTGCAGTTGG - Intergenic
1189686405 X:43568245-43568267 GAAGAGATAATCTATGGATTGGG + Intergenic
1189854242 X:45208164-45208186 GGAGAGAGAATCTGTGTCCTTGG - Intergenic
1189875801 X:45434534-45434556 AGAGAAAGAATCTGTGTACTTGG - Intergenic
1189884952 X:45533098-45533120 CAAGAGAGAGCCTGTGCACTTGG + Intergenic
1190046070 X:47112476-47112498 AGAGAGAGAATCTGTGCACTTGG + Intergenic
1190522895 X:51298409-51298431 GGAGAGAGAATCTGTGCATGTGG + Intergenic
1190537128 X:51440562-51440584 GGAGAGAGAATCTGTGCACTTGG + Intergenic
1190588244 X:51968543-51968565 GCATGGAGACTCTGTGCACTTGG - Intergenic
1190898924 X:54650294-54650316 GAAGAGAGAATCTGAGCACTTGG + Intergenic
1190908023 X:54747215-54747237 GGAGAGAGAATCTGACTACTTGG - Intergenic
1191179051 X:57540090-57540112 GGAGAGAGAATCCATGCACTTGG + Intergenic
1191722968 X:64249997-64250019 GAAGAAAGAATCAGAGAACTTGG - Intergenic
1191770900 X:64757095-64757117 GGAGAGTGAATCTGTGAGCTTGG - Intergenic
1191974229 X:66852246-66852268 GAAGAGAGAATGTGTGGAGGAGG - Intergenic
1191990963 X:67036623-67036645 GAAGGGAGAATCTCTGCACTTGG - Intergenic
1192597091 X:72422410-72422432 CAAGACAGAATCAGTGCACTTGG - Intronic
1192756760 X:74054798-74054820 GAAGAAAGAATCAGTGAACTTGG - Intergenic
1192793297 X:74405709-74405731 GGAGAGAGAATCTGTGCACTTGG + Intergenic
1192826838 X:74705554-74705576 GGAGAAAGAATCTGTGTGCTTGG - Intergenic
1192872573 X:75198846-75198868 GAAGAGAGAATCTCTGCACTTGG + Intergenic
1192875353 X:75223671-75223693 AGAGAGATAATCTGTGCATTTGG - Intergenic
1192890810 X:75389026-75389048 GGAGACAGACTCTGTGAACTTGG + Intronic
1192958906 X:76104995-76105017 GGAGAGGGAATCTGTGTGCTTGG - Intergenic
1193052511 X:77116093-77116115 GGGGAGAGAATCTGTGTACTTGG - Intergenic
1193125072 X:77862407-77862429 GAAGAGACAATCTGTTGAATGGG + Intronic
1193191232 X:78573322-78573344 GGAGAGAGAATCTGTGCATTTGG - Intergenic
1193295635 X:79828738-79828760 GAAAAGAGAAGCTGGGAACTGGG - Intergenic
1193329959 X:80224487-80224509 ACAGAGAGAATCTGTGTGCTTGG - Intergenic
1193335576 X:80285009-80285031 GGAGAGAGAATCTGTCTGCTTGG + Intergenic
1193366835 X:80644381-80644403 AGAGAGAGAATCTATGCACTTGG - Intergenic
1193561366 X:83021872-83021894 GGAGAGAGAATCCGTGCACTTGG + Intergenic
1193984754 X:88227388-88227410 GGAGAGCGTTTCTGTGCACTGGG + Intergenic
1194016143 X:88624279-88624301 GCAAAGAGAATCTGTGCACGTGG + Intergenic
1194095640 X:89635998-89636020 GGAGAAAGAATCTGTGCACTTGG + Intergenic
1194110116 X:89823775-89823797 AGAGAGACAATCTGTGCTCTAGG + Intergenic
1194189277 X:90815297-90815319 GAAGAGAAAAGCTATGCACATGG + Intergenic
1194196783 X:90903977-90903999 GTGCAGAGAACCTGTGCACTTGG - Intergenic
1194288657 X:92040508-92040530 AAGGAGAGAATCTTTGCACTTGG - Intronic
1194398085 X:93411426-93411448 AGAGAGAGAATCTGTGTGCTTGG + Intergenic
1194466545 X:94240761-94240783 GGAGTGAGAATCTGTGTGCTTGG - Intergenic
1194626221 X:96229494-96229516 AGAGAGAGAATCTGTGTGCTTGG + Intergenic
1194788600 X:98118189-98118211 GGAGAGAGAATCTGTGCACTTGG + Intergenic
1194937747 X:99971150-99971172 GGAGAGAGATTCTGTGTTCTTGG - Intergenic
1195115630 X:101695677-101695699 AGAGAGAGAATCTGTGCACTTGG + Intergenic
1195406643 X:104521881-104521903 GAGGATAGAATCAGTGAACTTGG - Intergenic
1195848095 X:109250086-109250108 GAAGAGAGAACCTATGAACTGGG - Intergenic
1195872251 X:109498643-109498665 GGAGAGATAATCTGTGCACTTGG - Intergenic
1196096886 X:111809490-111809512 GGAGACAGAATCTGTACACTTGG - Intronic
1196153115 X:112396262-112396284 ATAGAGAGAATCTGTGCATTTGG - Intergenic
1196217707 X:113072694-113072716 GGAGAAAGATTCTGTGCACTTGG - Intergenic
1196368736 X:114951948-114951970 GAAGAGAGAATCCATGTGCTTGG + Intergenic
1196478663 X:116120474-116120496 GAAGAAAGAATTAGTGAACTTGG - Intergenic
1196494463 X:116307752-116307774 GGAGAGAGTTGCTGTGCACTGGG - Intergenic
1196510221 X:116500306-116500328 GCACAGAGAGTCTGTGCACATGG - Intergenic
1196619475 X:117806307-117806329 AGAGAGAGAATCTGCGCACTTGG + Intergenic
1197030600 X:121809218-121809240 AAAGAGAGAATCTGTGTGCTTGG - Intergenic
1197177955 X:123504754-123504776 GGAGAAAGAATCTGTGCCCTTGG + Intergenic
1197181099 X:123538264-123538286 AAATAAAGAATCTGTGAACTTGG - Intergenic
1197375877 X:125681712-125681734 AAAGAGAGCATCTGTGTACCTGG + Intergenic
1197399864 X:125977330-125977352 TGAGAGAGAATCTGTGTGCTTGG + Intergenic
1197439216 X:126470255-126470277 GCATGGAGAATCTGTGTACTTGG + Intergenic
1197561814 X:128033733-128033755 AGAGAGAGAAGCTCTGCACTTGG + Intergenic
1197935484 X:131736323-131736345 GAAGAGCAAATCTAGGCACTGGG + Intergenic
1197953029 X:131918375-131918397 AGAAAGAGAATCTGTGCACTTGG + Intergenic
1198274130 X:135085551-135085573 GGAGAGAGAATCTGTGCACTTGG - Intergenic
1198283223 X:135163460-135163482 AAAGAAAGAATCTGTAAACTTGG + Intronic
1198287734 X:135209026-135209048 AAAGAAAGAATCTGTAAACTTGG - Intergenic
1198430942 X:136565543-136565565 GGAGAGAGAATCTGTGCACTTGG - Intergenic
1198578398 X:138036350-138036372 GGAGAGAGTATTTGTGCACTTGG + Intergenic
1198663303 X:138995143-138995165 GGAGAGAGAATCTGTGCACTTGG + Intronic
1198770691 X:140126929-140126951 GGAGAGAGAATCTGTGCACTTGG - Intergenic
1199018672 X:142848934-142848956 GAAGAAAGAGTCTGTGCATGTGG - Intergenic
1199197375 X:145047460-145047482 GAAGAGAGAATCTGTGCACTTGG + Intergenic
1199262096 X:145787081-145787103 GAAGAGACAACCTGTGGAATGGG + Intergenic
1199303834 X:146244373-146244395 GAAGAGAGAATCTGTGCATTTGG + Intergenic
1199314814 X:146364136-146364158 GGAGAGAAAATCAGCGCACTTGG - Intergenic
1199455309 X:148021223-148021245 AGAAAGAGAATCTGTGCACTTGG - Intronic
1199721262 X:150544195-150544217 GCAGAAAGAATCTGGGCGCTTGG + Intergenic
1199921125 X:152405140-152405162 AGAGAGAGAATCTGTGTGCTTGG + Intronic
1200177197 X:154125507-154125529 AGAGAGAGAAGCTGTACACTTGG + Intergenic
1200364369 X:155645649-155645671 AGAGAGAGAATCTGTGCATTTGG - Intronic
1200379420 X:155819370-155819392 GAAGAGAGAATTTGTGTGCTTGG + Intergenic
1200448639 Y:3297366-3297388 GGAGAAAGAATCTGTGCACTTGG + Intergenic
1200462775 Y:3478516-3478538 AGAGAGACAATCTGTGCTCTAGG + Intergenic
1200535854 Y:4397190-4397212 GAAGAGAAAAGCTATGCACATGG + Intergenic
1200542630 Y:4478178-4478200 GTGCAGAGAACCTGTGCACTTGG - Intergenic
1200606178 Y:5265073-5265095 AAGGAGAGAATCTTTGCACTTGG - Intronic