ID: 1014378647

View in Genome Browser
Species Human (GRCh38)
Location 6:120711132-120711154
Sequence AAGAGAGAATCTGTGCACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 879
Summary {0: 11, 1: 48, 2: 106, 3: 220, 4: 494}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014378645_1014378647 0 Left 1014378645 6:120711109-120711131 CCTTGGCAGTGGCACATGACATG No data
Right 1014378647 6:120711132-120711154 AAGAGAGAATCTGTGCACTTGGG 0: 11
1: 48
2: 106
3: 220
4: 494

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014378647 Original CRISPR AAGAGAGAATCTGTGCACTT GGG Intergenic
900144188 1:1150830-1150852 CAGAGGGAATCTGGGGACTTGGG - Intergenic
902505472 1:16936942-16936964 AAGGGAGCATCTGTTCACTAGGG + Intronic
902661632 1:17908297-17908319 AAGAGAGAAGCTCTGAACTTTGG + Intergenic
903154455 1:21434609-21434631 AAGGGAGCATCTGTTCACTAGGG + Intergenic
904183805 1:28686853-28686875 AAGCCATAATCTGTGCACTTGGG + Intronic
905443544 1:38009654-38009676 AAGAAAGCATCTGGGCAATTTGG - Intronic
905739813 1:40360667-40360689 CAGAGAGAATCAGTGTGCTTGGG + Intronic
906538817 1:46569243-46569265 AAGAGAAAACCTCTGCACTTTGG + Intronic
908363278 1:63390824-63390846 AAGAGAGAATCTGTGTGTTTGGG - Intronic
908408752 1:63842442-63842464 AGGAGAGAAACTCTGAACTTAGG + Intronic
909084619 1:71155997-71156019 CAGAGAGGATCTGTGCACTTGGG - Intergenic
909209817 1:72808778-72808800 GAGAGAGAAGCTGTGTACTTGGG - Intergenic
909728662 1:78867518-78867540 AAGAGAGACTTTGTTGACTTGGG - Intergenic
909902971 1:81160893-81160915 CACATAGAATCTGTGCACCTGGG + Intergenic
909919180 1:81359098-81359120 AAAAGAAAATCTGTGTAGTTGGG + Intronic
910160428 1:84266729-84266751 TCAAGAGACTCTGTGCACTTGGG - Intergenic
910289652 1:85588023-85588045 TGCAGAGAATCTGTGCTCTTGGG + Intergenic
910349428 1:86278335-86278357 GAGAATGAATCTGTGTACTTTGG - Intergenic
910358622 1:86392628-86392650 AAGAATGAATCAGTGGACTTTGG + Intronic
910627402 1:89322722-89322744 GAGAGAGAATCTGTGTGCTTGGG - Intergenic
911011603 1:93287155-93287177 CAGGGAGAATCTGTGCTCTTGGG + Intergenic
911012604 1:93297082-93297104 GAGAGAGAATCTGTGCATTTTGG - Intergenic
911241477 1:95471746-95471768 GACAGACAATCTGTGCACTTGGG - Intergenic
911486318 1:98511007-98511029 AAGATAAAATCGGTGCACTTGGG - Intergenic
911487054 1:98515574-98515596 GAGAGAGAATCTATACACTTGGG + Intergenic
911752302 1:101509497-101509519 AGGGGAGAATCTCAGCACTTCGG + Intergenic
911942864 1:104069538-104069560 GAGATAGAATCTGTGCACTTTGG - Intergenic
911960839 1:104300890-104300912 GAGAGACAATCTGGGCATTTCGG + Intergenic
912015234 1:105026663-105026685 GAGAGAGAATCTGTTTTCTTGGG + Intergenic
912116862 1:106418131-106418153 GAGAGAGAATCTGTGCACTTAGG + Intergenic
912316303 1:108670229-108670251 CACAGAGAGTCTATGCACTTGGG + Intergenic
912616884 1:111110730-111110752 AAGAGAGAATCTCTGTGCTTGGG - Intergenic
912949450 1:114110726-114110748 AAGGGAGAAGCTGTGCAGCTTGG - Intronic
913106121 1:115615736-115615758 AAGAAAACCTCTGTGCACTTGGG - Intergenic
913147194 1:116003649-116003671 AAGAGAGAATCTGTGTGCTTGGG - Intronic
914958419 1:152185218-152185240 AAGAGAGGATGTTTGCATTTGGG + Intergenic
915185821 1:154104511-154104533 GAGAGAGAATCTGTGCACCTGGG + Intronic
915693762 1:157717142-157717164 TAGAGAGAATTCGTGCAGTTGGG - Intergenic
915752658 1:158226736-158226758 GAGAGAGAATCTATGTGCTTAGG + Intergenic
916475465 1:165164496-165164518 CAGAGACCTTCTGTGCACTTTGG + Intergenic
917300682 1:173570857-173570879 GAGAGAGAATCTGTGCACTTGGG - Intronic
917405046 1:174696703-174696725 GAGAAAGAATCCATGCACTTGGG - Intronic
918323491 1:183387648-183387670 AAGACAGAAGCTGGGCATTTGGG - Intronic
918549970 1:185731250-185731272 AAGAGAGCATCAGTGAACTGTGG + Intergenic
918752690 1:188292514-188292536 GAGAGAAAAACTGTGCACTTGGG + Intergenic
918915880 1:190635548-190635570 CAGACAGAATCTGTGCACTTAGG - Intergenic
919169698 1:193938527-193938549 AAGAGAGAATCTGTGCACTTGGG + Intergenic
919393080 1:197012030-197012052 AAAAGAAACTCTGTACACTTTGG - Intergenic
919441391 1:197637925-197637947 CAGAAAGAGTCTCTGCACTTCGG + Intronic
919455765 1:197818246-197818268 AAGAGAGAATCTGTGCTTTGGGG + Intergenic
919515028 1:198511726-198511748 GAGAGAGAATTTGTGTGCTTGGG - Intergenic
919823981 1:201490796-201490818 AAGAGACTATCTGTGCATGTTGG + Intronic
920595053 1:207260323-207260345 GAGAGAGAATCTGTGTGCTTGGG - Intergenic
921146941 1:212367339-212367361 CAGAGAGAATCTGTGAGCTTGGG + Intronic
921393119 1:214637284-214637306 AAGACAGAGTCTCTGCCCTTGGG - Intronic
921833209 1:219751210-219751232 AAGACAGAGTCTGTGAACCTTGG - Intronic
921929508 1:220743581-220743603 AAGAGAGAGTCTGTGCTCTTGGG - Intergenic
922044184 1:221927854-221927876 GTGAGATAATCTGTGCACTTAGG + Intergenic
923625552 1:235611143-235611165 GAGAGAGAATCTCTGCCCTGTGG - Intronic
923872121 1:238006785-238006807 AAGAGAGAAGCTGGGCACGGTGG - Intergenic
924147212 1:241088749-241088771 AAGAGAGAACAGGAGCACTTTGG + Intronic
924147333 1:241089743-241089765 AAGAGAGAACAGGAGCACTTTGG + Intronic
924516328 1:244769036-244769058 AAAAGAGAACCTGTGTGCTTGGG - Intergenic
1063155854 10:3378700-3378722 AAGAGAGGATGTCTCCACTTCGG + Intergenic
1063855201 10:10242313-10242335 GAGAGAGATACTGTCCACTTGGG - Intergenic
1064446460 10:15398323-15398345 CACAGAGAATCTGTGTACTTTGG + Intergenic
1064521792 10:16210320-16210342 GATGGAGAATCTGTGCTCTTGGG - Intergenic
1065921711 10:30398934-30398956 GAGAGAGAATCTGTGCACTTGGG + Intergenic
1066143113 10:32527239-32527261 GAGAAAGAATCTGTGCACTTTGG - Intronic
1067258198 10:44663522-44663544 GAGATTGAATCTGTGAACTTTGG - Intergenic
1067324395 10:45253305-45253327 CACAGAGAATCTGTGTGCTTTGG + Intergenic
1068706596 10:60083456-60083478 AACAGAGAATCTGTGAATTATGG - Intronic
1069056153 10:63847091-63847113 GAGAGAGAATCTGTGCATTTGGG + Intergenic
1069343312 10:67438716-67438738 GAGAGAGAATCTGTGCACAAGGG + Intronic
1070158721 10:73852540-73852562 ATTAGTGAATCTGTGCATTTTGG - Intronic
1071896843 10:90076849-90076871 GTGAGAGAATCTGTGCATTTGGG - Intergenic
1071962544 10:90821305-90821327 CATAGAGAATCCGTGCACTTGGG + Intronic
1072058664 10:91787360-91787382 GAGAGAGAATCTGTGTGCTTGGG + Intergenic
1072476524 10:95766249-95766271 AAGAGAAAATCTTTGTTCTTAGG - Intronic
1072853764 10:98925047-98925069 GAGAGAGAACTTGAGCACTTTGG - Intronic
1073287436 10:102397274-102397296 AAGAGAGAATCGGAGGCCTTTGG - Intronic
1073872308 10:107879630-107879652 GAGAGAGAATCTGTGCACTTGGG + Intergenic
1074038313 10:109762777-109762799 GAAAGATAATCTGTGCTCTTGGG - Intergenic
1074410494 10:113223979-113224001 AAGAGAACATCCTTGCACTTGGG + Intergenic
1075338900 10:121629874-121629896 AAGAGTGGATCTGTGCAGTTTGG - Intergenic
1076297072 10:129394383-129394405 AAGATAAAATCAGTGTACTTGGG - Intergenic
1076376703 10:129993121-129993143 GAGAGAGAATCTGTGCACTTGGG + Intergenic
1077427324 11:2489217-2489239 GAGAGAGAATCTGAGAGCTTGGG + Intronic
1077835366 11:5922640-5922662 GAGAGAGAATCTGTTAACTTTGG + Intronic
1078690777 11:13578710-13578732 GAGAGAGAATCTGTGCACTTGGG + Intergenic
1078992518 11:16664362-16664384 GAGAAAGAATCTGTACACTTGGG + Intronic
1079474002 11:20808822-20808844 CAAAAAGAATCTGTGCACTAAGG - Intronic
1079530654 11:21448027-21448049 CAGAGAGAATCTGTGCGTTTGGG - Intronic
1080128463 11:28765886-28765908 GAGAGAGATTCTGTGCATTTGGG + Intergenic
1082952879 11:58836660-58836682 AAAATAAAATCTGTCCACTTGGG - Intronic
1083301514 11:61741906-61741928 AAGAGTGAATCTGTGCAGGCCGG - Intronic
1083335403 11:61918913-61918935 AAGAGAGAATCCCTGCCCTCTGG - Intronic
1083512892 11:63227960-63227982 CACAGAGAATCTGTGCACTTGGG - Intronic
1083538979 11:63498489-63498511 AGAAGAGAATCTGTGCACTCTGG - Intergenic
1084023190 11:66430643-66430665 AAGAAAGAACCTGTGTACTGTGG + Intergenic
1084351690 11:68605555-68605577 AAGAGAGTATCTTTACAGTTTGG + Intronic
1084721178 11:70906618-70906640 ACGAGAGAAACCGAGCACTTGGG + Intronic
1084763965 11:71295426-71295448 GAGGGAGAATCTGTGCACTCTGG - Intergenic
1085686913 11:78631742-78631764 AGGAGAGAATCTGTGTGCTTAGG - Intergenic
1085914665 11:80870939-80870961 AAAAGATAATCTCTGCACTAAGG - Intergenic
1086249842 11:84799352-84799374 AAGAGAGAATCTGTGCACTTGGG - Intronic
1087012993 11:93530795-93530817 GAGAAGGAATGTGTGCACTTGGG - Intronic
1087032141 11:93716307-93716329 GAGAGAGAATCTGTATGCTTGGG - Intronic
1087112851 11:94489981-94490003 AAAAGAGGATTTGTGTACTTTGG - Intronic
1087222445 11:95560877-95560899 AATAGAGAATCAGTGAAATTTGG - Intergenic
1087299186 11:96412940-96412962 GAGAGAGAATATGTACTCTTGGG + Intronic
1087549078 11:99623758-99623780 AAGATAAAAGCTGTGCACTAAGG + Intronic
1087598532 11:100284086-100284108 AAGAGAAAATCTGTTTGCTTGGG - Intronic
1087691149 11:101321567-101321589 GAGAGAGAATCTGTATTCTTGGG - Intergenic
1087721082 11:101665900-101665922 CACAGAGAGTCTGTGCACTTGGG - Intronic
1087871315 11:103296036-103296058 CAGAGAGAATCTGTGTGCGTAGG - Intronic
1087887466 11:103497129-103497151 CAGAGAGAATCTGTGCACTTTGG + Intergenic
1088135926 11:106555138-106555160 TATAGAGAATCTATGCACTTTGG - Intergenic
1088181702 11:107120732-107120754 GTGAGAGAATCTGTGTGCTTGGG + Intergenic
1088944586 11:114496337-114496359 GAGGGAAAATCTGTGCACTTGGG - Intergenic
1088985078 11:114898782-114898804 GAGAGAAAATCTGAGAACTTGGG + Intergenic
1089183538 11:116599150-116599172 GAGAGAGAATAGGAGCACTTTGG - Intergenic
1089806877 11:121098359-121098381 AAGAGAGAGTTTGTTGACTTAGG - Intergenic
1090111096 11:123910462-123910484 CATGTAGAATCTGTGCACTTTGG + Intergenic
1090232625 11:125119575-125119597 AAGAGAGAATCTGTCCCCATTGG + Intergenic
1090317598 11:125807802-125807824 CACAGAGACCCTGTGCACTTGGG + Intergenic
1090339852 11:126007794-126007816 ATGATATAATCTGGGCACTTGGG + Intronic
1090902207 11:131043105-131043127 AAGAGAGACTCAATGCATTTAGG + Intergenic
1091275969 11:134350450-134350472 GAGAGAGGATCTGTGCATTTGGG - Intronic
1091841290 12:3623129-3623151 AAGAGAGAAGCAGTGCAGTGTGG + Intronic
1092297837 12:7215648-7215670 AAGTGAGAATCTGTGGTATTTGG - Intronic
1092670752 12:10858294-10858316 AATGGAGAATCTGTAGACTTGGG + Intronic
1092889853 12:12959073-12959095 AAGTGAGAATCTGTGGTATTTGG + Intergenic
1093122898 12:15294581-15294603 CAGAGGGAATGTGTGCACTTAGG + Intronic
1093324913 12:17761263-17761285 AAGAGATCGTCTGTGCACTTGGG - Intergenic
1093403454 12:18776584-18776606 GAAAGAGAATCTGTGCTTTTGGG + Intergenic
1093581738 12:20791219-20791241 CAGAGAGAATCTGTGCACTGTGG - Intergenic
1093619887 12:21276713-21276735 GAGAAGGAATCTGAGCACTTGGG + Intronic
1093858976 12:24140025-24140047 AAGAAATAATCTGTTCATTTAGG - Intergenic
1095163208 12:38941063-38941085 GAGAGAGAATCTGTACACTTTGG + Intergenic
1095181829 12:39154830-39154852 CAAAGAGAATCTGTGCACTTGGG - Intergenic
1095573505 12:43709299-43709321 AAGAGAGAATCTGTTTGTTTGGG - Intergenic
1095860136 12:46907777-46907799 GAGAGAGAATCTGTGCACTTGGG + Intergenic
1096344075 12:50829504-50829526 CAGAGAGCATCTGTGTGCTTTGG - Intergenic
1097153288 12:56994994-56995016 AAGAAAGTATCTCTGCTCTTGGG + Intronic
1097508509 12:60506908-60506930 AAGAGAAAGTCTGTGCACTTGGG + Intergenic
1097899392 12:64857924-64857946 GAGAAAGAGTCTGTGCACTTGGG - Intronic
1098031869 12:66263356-66263378 AAAAGAGAATCCCAGCACTTTGG - Intergenic
1098262870 12:68688590-68688612 AAGAGAGAATTCCTGCAGTTAGG + Intronic
1098395196 12:70010188-70010210 GAGAGACAATCTGTGCACTTGGG + Intergenic
1098503838 12:71226539-71226561 GAGAAAGAATCTGTGCACTTGGG + Intronic
1098667483 12:73181485-73181507 AAGAGATAATCTGTGAGCTTGGG - Intergenic
1098922735 12:76317368-76317390 AAGAGAAAATCTGTGTCCTTGGG + Intergenic
1099101017 12:78440119-78440141 GAGAGAGAATCTGTGTGCTTGGG - Intergenic
1099156450 12:79182347-79182369 AAGAGAGAATAAGAGCATTTAGG - Intronic
1099548557 12:84014307-84014329 GAGAGAGAATCTGTGCACATGGG - Intergenic
1099562340 12:84193598-84193620 GGGAGAAAATCTGTGCACTTTGG - Intergenic
1099807828 12:87542787-87542809 AGGAGGGAATCAGTGCACTTGGG + Intergenic
1099826233 12:87780576-87780598 GAAAGAGAATCTGTGCATTTTGG - Intergenic
1099882078 12:88479528-88479550 GAGAGAGAATCTAAGCGCTTGGG + Intergenic
1100061117 12:90576452-90576474 GAGAGAGAATCTGAGCACTTCGG - Intergenic
1100904803 12:99285731-99285753 GAGAGAGAATCTGTGTGCTTGGG + Intronic
1100996735 12:100308921-100308943 GAGACATAATCTGTGCACTTGGG - Intronic
1101042424 12:100770365-100770387 AAGAAAGAATCTGAACTCTTAGG - Intronic
1101252106 12:102946581-102946603 GACAGAGAATCTGTGTGCTTCGG - Intronic
1101393689 12:104324934-104324956 AAAAGAGAATCTCTGAATTTGGG + Intronic
1101539137 12:105648810-105648832 GTGAGAGAATAAGTGCACTTTGG + Intergenic
1103416061 12:120742005-120742027 AAGAGCCAGTCTGTGCACTCGGG + Intergenic
1103975427 12:124699637-124699659 CAGAGGGATTCTGTGCACATTGG + Intergenic
1104097562 12:125571679-125571701 AAGAGAGAATATGCACATTTGGG - Intronic
1104680946 12:130751248-130751270 AAGAGAGCAACTGTGAACTCAGG - Intergenic
1105938134 13:25120739-25120761 GAGAGAGAATCTTTGTGCTTGGG + Intergenic
1106220451 13:27742407-27742429 AAGAGAGATTCTGAGCAGATTGG + Intergenic
1106550631 13:30767930-30767952 AAGAGATAATCTGTGCAACTGGG + Intergenic
1106855455 13:33846884-33846906 AAGAGAGAATCTGTGTGCACTGG - Intronic
1106963948 13:35037674-35037696 GAGAGAGACTCTGTGTGCTTGGG - Intronic
1107377954 13:39824893-39824915 CAAAGAGAATCTGTTGACTTCGG + Intergenic
1107582142 13:41802192-41802214 GAGAAAGAATCTGTGTGCTTGGG + Intronic
1108889903 13:55244555-55244577 AGCAGAGAATCTGTGCCTTTAGG + Intergenic
1108997136 13:56748249-56748271 GAGAAATAATCTATGCACTTGGG - Intergenic
1109211370 13:59538987-59539009 GAGAGAGAGTCTATGCACTTGGG - Intergenic
1109336785 13:61004298-61004320 GAGACAGAATCTGTGTGCTTGGG - Intergenic
1109352050 13:61195393-61195415 CGGAGAGAACCTGTGCACTTGGG + Intergenic
1109583704 13:64371850-64371872 AAGAGAGAATCTGTTTTCTTGGG - Intergenic
1109854601 13:68110772-68110794 CAGAGAGAATCTATGCATTTGGG + Intergenic
1109900485 13:68762936-68762958 AAGAGAGAATCTGTGAAACTGGG + Intergenic
1109923724 13:69106174-69106196 GAGAGAGAACCTGTGGGCTTGGG + Intergenic
1111085924 13:83374688-83374710 GAGAGAGAATTTGTGTGCTTGGG - Intergenic
1111215162 13:85132142-85132164 AAGAGAGGGCCTGTGCACTGAGG - Intergenic
1111482591 13:88850804-88850826 AAGACAGAACCTGGGCCCTTGGG - Intergenic
1111583456 13:90253767-90253789 GAGAGAGAACCTGTGTGCTTGGG - Intergenic
1111642792 13:90992243-90992265 AATTAAGAATCTGTGCATTTAGG - Intergenic
1111825703 13:93264320-93264342 ACTAGAGCATCTGTGCATTTTGG - Intronic
1112743208 13:102497772-102497794 CAGAGAGAATCTGTGTGCTTGGG + Intergenic
1112940313 13:104854119-104854141 GAGAGAGAATTTGTGCACTTGGG + Intergenic
1112944507 13:104910773-104910795 AAGAGAGAATCTGTGCACTTGGG - Intergenic
1113213021 13:108004073-108004095 AAGAGAGAATCTGTACACTTGGG - Intergenic
1113253822 13:108485620-108485642 TATGGGGAATCTGTGCACTTAGG + Intergenic
1113558490 13:111257752-111257774 GAGAGAAAACCTGTGCACTTCGG + Intronic
1113876801 13:113599760-113599782 GAGAGAGAATCCTTGCACTTAGG + Intronic
1113876850 13:113600060-113600082 GAGAGAGAATCCTTGCACGTAGG + Intronic
1113876869 13:113600172-113600194 GAGAGAGAATCCTTGCACGTAGG + Intronic
1113876909 13:113600392-113600414 AAGCGAGAATCCTTGCACTTAGG + Intronic
1113876976 13:113600783-113600805 GAGAGAGAATCCTTGCACGTAGG + Intronic
1114072543 14:19126332-19126354 GAGAGAGACTCTGTGTTCTTGGG - Intergenic
1114089714 14:19273643-19273665 GAGAGAGACTCTGTGTTCTTGGG + Intergenic
1114761703 14:25322996-25323018 CACAGAGAATTTGTGCTCTTGGG - Intergenic
1114783852 14:25570978-25571000 GACAGAGAATCTGTGCACTTTGG - Intergenic
1114968825 14:28000856-28000878 CACAGAAAATCTGTGCTCTTGGG + Intergenic
1115133825 14:30085787-30085809 CATGGAGAATCTGTGCACTTAGG + Intronic
1115282507 14:31679119-31679141 CACAGAGAATCTGTGTGCTTGGG - Intronic
1115660881 14:35493582-35493604 AAGAGAGAATTTGTGTACTTGGG + Intergenic
1115964001 14:38866201-38866223 AAAAGAGAATATGGTCACTTTGG + Intergenic
1116045603 14:39739674-39739696 CAGAAAGAATCTGTGTGCTTTGG + Intergenic
1116114871 14:40635364-40635386 GAGAAAGAACCTGTGCATTTTGG + Intergenic
1116257006 14:42570148-42570170 TAGACAGAATCTGTGTGCTTGGG + Intergenic
1116392723 14:44413018-44413040 TAGAGATAAACTGTGCACTTAGG + Intergenic
1116480943 14:45391308-45391330 CATAGAGAATCTGTGTGCTTGGG + Intergenic
1116888941 14:50248976-50248998 GAGACAGAACCTATGCACTTGGG + Intronic
1117110260 14:52446237-52446259 AAGAGAGAATCTATGTGTTTGGG + Intronic
1117384374 14:55195834-55195856 GAGAGAGAATCTGTGCACTTTGG - Intergenic
1117504551 14:56389133-56389155 GAGAGAAAATCTGTGCACTTGGG - Intergenic
1117596460 14:57331269-57331291 AACAGAGTAACTGTGCACTGGGG - Intergenic
1117607112 14:57440984-57441006 CATAGAGAATCTGTGCACTTAGG - Intergenic
1117795549 14:59389393-59389415 GAGAGAGAATCTGTGCACTGAGG - Intergenic
1117843144 14:59881531-59881553 GAGAGAGAATCTTTGCATTTAGG - Intergenic
1117870650 14:60197427-60197449 GAGAGAGAATCTGTGCATTTGGG + Intergenic
1117996922 14:61486623-61486645 AAAAGAGCATATGTGCAATTAGG - Intronic
1118241285 14:64060954-64060976 GAGAAAGAATCCGTGCACGTGGG - Intronic
1118543428 14:66857834-66857856 GAGAGAGAATCTGTGCATTTGGG + Intronic
1118962284 14:70545316-70545338 CACAGAGAATCTGCGCACTTGGG + Intergenic
1119809493 14:77504711-77504733 AAGAGAAAATCTGTGACTTTAGG - Intergenic
1120100000 14:80434449-80434471 GAGAGAGAATCTGTGTGCTTGGG + Intergenic
1120107862 14:80516769-80516791 GAGAGAGAATCTGTGTGTTTTGG - Intronic
1120426065 14:84350269-84350291 GAGAGAGAATCTGTGCTTGTGGG + Intergenic
1120467844 14:84884515-84884537 GAGAGAGAATCTGTGTGCTTGGG + Intergenic
1120490121 14:85167116-85167138 AAGAAAGAATGTGTTTACTTAGG + Intergenic
1120660357 14:87240901-87240923 AAGATAGAATTTGTGAACCTTGG - Intergenic
1121375824 14:93410128-93410150 GAGAGAGAATCTGGACACTTGGG + Intronic
1121979447 14:98442011-98442033 AAGAGAGGATCTCTGAGCTTAGG + Intergenic
1123502462 15:20902440-20902462 TAGACAGAATCTGTACACTTGGG + Intergenic
1123559712 15:21476107-21476129 TAGACAGAATCTGTACACTTGGG + Intergenic
1123595946 15:21913406-21913428 TAGACAGAATCTGTACACTTGGG + Intergenic
1125277120 15:38004714-38004736 CAGAGAGAATCTGTGCACTTTGG - Intergenic
1125366808 15:38926305-38926327 AAGAGAGAATATGTGGTATTTGG + Intergenic
1125567588 15:40688976-40688998 AAGAGAGAATGGGTGCTCCTGGG + Intergenic
1126199979 15:45974613-45974635 AAGGTAGAATCTATGGACTTTGG + Intergenic
1126246868 15:46517782-46517804 TAGAGAGAATCTGTGTGATTTGG + Intergenic
1126534034 15:49741583-49741605 GAGAGAAAATCTGTGTTCTTGGG + Intergenic
1126660835 15:51031495-51031517 GAGAGAGAATATGTGTGCTTTGG - Intergenic
1126716553 15:51524576-51524598 GAGAGAGTTTCTGTGCACTGGGG + Intronic
1127019279 15:54727645-54727667 AAGAGAGAGCCTGTGCTCTTGGG - Intergenic
1127132521 15:55882339-55882361 CATGGAGAATCCGTGCACTTAGG + Intronic
1127971653 15:63966758-63966780 GAGAAAGAACCTGTGCACTTGGG - Intronic
1129061993 15:72867553-72867575 GAGAGAGAAGCTGTGTAGTTGGG + Intergenic
1129104472 15:73296550-73296572 AGCAGTGAATCTGTGCCCTTGGG - Intronic
1129561585 15:76576719-76576741 GACAGAGAGTCTATGCACTTGGG + Intronic
1130511670 15:84594793-84594815 CTGAGAGAATCTGTGCACTTGGG + Intergenic
1131315241 15:91329787-91329809 GACAGAGAATCTGTGTACTTTGG - Intergenic
1131633053 15:94200058-94200080 CAGAGTGAATCTGTGCACAATGG + Intergenic
1202968054 15_KI270727v1_random:203269-203291 TAGACAGAATCTGTACACTTGGG + Intergenic
1133087713 16:3377974-3377996 AAGAGGAAATCTGTAGACTTGGG + Intronic
1133346879 16:5077106-5077128 AAGAGAGAGGATGTTCACTTTGG + Intronic
1137889010 16:52138543-52138565 AAGATCAAATCTGTGTACTTGGG + Intergenic
1138085116 16:54126576-54126598 AAGAGAGAAATTTTGCTCTTGGG + Intergenic
1138795987 16:59969385-59969407 AAGTGAGAATATGTGCTGTTTGG + Intergenic
1138806935 16:60100931-60100953 GAGAGAGAATCTATGCATTTGGG - Intergenic
1138856604 16:60701286-60701308 AAGAGAGAAGCTGGGCACAGTGG + Intergenic
1139798419 16:69501347-69501369 AAGAGATAATCCCAGCACTTTGG - Intergenic
1140946388 16:79771902-79771924 AGTACAGAATCTGTGCATTTGGG - Intergenic
1141060882 16:80868339-80868361 AAGTGAGAATATGTGCTATTTGG - Intergenic
1141339839 16:83192953-83192975 AAGAGAGGAACTATGTACTTGGG + Intronic
1143149444 17:4798487-4798509 CACAGAGAATCTTTGTACTTTGG + Exonic
1143348868 17:6271982-6272004 AAGACAGAATTTTTGCCCTTAGG + Intergenic
1145069078 17:19787885-19787907 AGGAAATAATCTGTGTACTTGGG + Intronic
1145970641 17:28954507-28954529 AAAATAAAATCTGAGCACTTTGG + Intronic
1146216735 17:30982445-30982467 CACAGAGAATCTGTGCACTCAGG - Intronic
1147129601 17:38399243-38399265 AAGAGAGAATTTATGCAATGTGG + Intronic
1147312660 17:39604504-39604526 GAGCGCGGATCTGTGCACTTTGG - Intronic
1148716636 17:49720480-49720502 AAGAGGGACCCAGTGCACTTTGG - Intronic
1149088353 17:52748428-52748450 AAAAGAGAATCTGCTCTCTTGGG - Intergenic
1149231174 17:54536375-54536397 GAAACAGAATTTGTGCACTTAGG + Intergenic
1150237155 17:63602282-63602304 GAGAGAGAAACTGTGGACTTTGG + Intronic
1150518011 17:65835100-65835122 AAGTGAGAACCTGTGGTCTTTGG - Intronic
1150531699 17:65990446-65990468 CAGATAGCATCTGTGCTCTTGGG + Intronic
1150541387 17:66103799-66103821 AAGAGAGAATCTGTGTATTTGGG + Intronic
1150550240 17:66203425-66203447 GAGGGAGAATCTGTGTGCTTGGG + Intergenic
1153129134 18:1834532-1834554 TGGGGAGAATCTATGCACTTGGG + Intergenic
1153354750 18:4122842-4122864 AAGGGAGAACCTTTGCTCTTTGG - Intronic
1153797584 18:8638862-8638884 GAGAGAGATTCTGTGGCCTTAGG - Exonic
1153880777 18:9420049-9420071 AACAGAAACTCTGAGCACTTTGG + Intergenic
1154230458 18:12551953-12551975 CAGAGAGAATCTGTGTGCTTGGG + Intronic
1154407380 18:14106774-14106796 TAGATAGAAGCTGTACACTTGGG + Intronic
1155726143 18:29085943-29085965 AAGTGAAAATCTGTGCAGCTGGG - Intergenic
1155767343 18:29652344-29652366 CATGGAGAATCTGTGCATTTGGG + Intergenic
1156021676 18:32606545-32606567 GAGAGAGAATCTATGTGCTTGGG - Intergenic
1156094153 18:33509586-33509608 CAGAGAGAAACTGTGAACTTGGG + Intergenic
1156411336 18:36830402-36830424 AGAAGAGAATATGTGCACTGTGG + Intronic
1156531088 18:37815936-37815958 AATAGAAAATATGTGCTCTTTGG + Intergenic
1156668513 18:39438158-39438180 AAGAAATAATCTTTGCATTTTGG + Intergenic
1156848856 18:41702065-41702087 ATGAGAGAATCTTTTCACCTGGG - Intergenic
1156912494 18:42426877-42426899 TGCAGAGAATCTGTTCACTTGGG - Intergenic
1157022745 18:43806104-43806126 GAGAGAGAATCTGGGTACTTGGG - Intergenic
1157943207 18:51951588-51951610 AAGAGAGAACCGCTGCACTAAGG + Intergenic
1158468382 18:57712315-57712337 GAGAGAAAATCTGTACGCTTGGG + Intronic
1158949175 18:62475842-62475864 GAGAGAGAATCTGCACATTTTGG - Intergenic
1159220584 18:65458740-65458762 AACAGAGATTCTGTTAACTTTGG - Intergenic
1159415905 18:68149066-68149088 GAGAGAGAATCTTTGTTCTTGGG + Intergenic
1159490665 18:69129541-69129563 GAGAGAGAATCTGTGCACTCAGG - Intergenic
1159772308 18:72560259-72560281 CAGAGATCATCTGTGCACGTAGG + Intronic
1160618819 18:80155429-80155451 AAAATAGTATTTGTGCACTTAGG + Intronic
1161925971 19:7300102-7300124 AAGATCAAATCAGTGCACTTGGG + Intergenic
1163876206 19:19870875-19870897 ATGAGAGCAGCTGTGTACTTTGG + Intronic
1163879765 19:19908421-19908443 CTGAGAGTAGCTGTGCACTTTGG + Intronic
1163893102 19:20034159-20034181 CTGAGAGTAGCTGTGCACTTTGG - Intronic
1163918788 19:20268216-20268238 CTGAGAGTAGCTGTGCACTTTGG - Intergenic
1163924274 19:20324146-20324168 CTGAGAGTAGCTGTGCACTTTGG + Intergenic
1163933052 19:20416896-20416918 CAGAGAGTAGCTGTGCACTTTGG - Intergenic
1163935922 19:20443331-20443353 CTGAGAGTAGCTGTGCACTTTGG + Intergenic
1164124442 19:22299131-22299153 CTGAGAGTAGCTGTGCACTTTGG + Intronic
1164140500 19:22457474-22457496 CTGAGAGTACCTGTGCACTTTGG + Intronic
1164603186 19:29577532-29577554 AAGTGAGCATCTGGCCACTTTGG - Intergenic
1164916029 19:32053005-32053027 ATGAGAGAAGCTGGGCAGTTGGG + Intergenic
1165232443 19:34395549-34395571 AAAAAAGAAGCTGTGCACTCTGG + Intronic
1166757720 19:45203795-45203817 GAGAGAGAATCTGTGCATTTGGG - Intronic
925484843 2:4316551-4316573 AAGAGAGAATCTGTACACTTGGG - Intergenic
925506442 2:4569915-4569937 GAGAGAGAATCTGAGAACTAGGG - Intergenic
925588466 2:5486917-5486939 GAGAGAGAATCTGTAAGCTTGGG + Intergenic
926473648 2:13293848-13293870 AAGAGAGAATCTGTGTGCTTTGG - Intergenic
926518745 2:13883388-13883410 GAGAGAGAATCTGTGCACAGTGG + Intergenic
926852314 2:17213518-17213540 AAGAAAGAATCTGTGAACTCAGG - Intergenic
927039001 2:19209296-19209318 AGGAAAGAAAATGTGCACTTTGG + Intergenic
927823136 2:26286836-26286858 AAGAGAAAATCTGTTCACATCGG - Intronic
928295974 2:30084467-30084489 GAGGCAGGATCTGTGCACTTGGG + Intergenic
928483950 2:31710967-31710989 GAGAGAGAATCTGTGTGCTTGGG + Intergenic
928495747 2:31829748-31829770 CACAGAGAATCTGTGCATTTTGG - Intergenic
928611886 2:32999364-32999386 AAGACAGAATCTGTGAGGTTGGG + Intronic
928715655 2:34056721-34056743 GAGACAGAATCTGTGCCCTTGGG - Intergenic
928846270 2:35676880-35676902 GAGGGGGAATCTGTGCACTTGGG - Intergenic
930230821 2:48842066-48842088 GAGAAAGAATCTGCACACTTTGG - Intergenic
930312937 2:49764593-49764615 AGGACAGGATGTGTGCACTTAGG + Intergenic
930439791 2:51391244-51391266 GAGACAGAATCTGGGCACTTGGG - Intergenic
930727227 2:54694206-54694228 GAGAGAGAATCTGTGCACTTGGG + Intergenic
930947587 2:57093420-57093442 AAGAGAAAAGCTGTGTGCTTTGG - Intergenic
930971404 2:57398824-57398846 CAGAGAGAGACTGTGCACTTGGG - Intergenic
931407016 2:61988970-61988992 TAGAGAGAATCTGTGTGTTTGGG - Intronic
931582897 2:63796533-63796555 AAGAGATAATCTGTGTGCTTGGG + Intronic
931736395 2:65198711-65198733 GAGGGAGACTCTGTGCCCTTGGG + Intergenic
933242026 2:79932357-79932379 AAGAGGGAACCAGTGAACTTGGG + Intronic
933341745 2:81034446-81034468 AGGAGAGAATCTTTGTACTTGGG - Intergenic
933382941 2:81572995-81573017 AAGAGAGAACCTGTGAAATTTGG - Intergenic
933460946 2:82584575-82584597 AAGAGAGAATATATTCACGTGGG - Intergenic
933601094 2:84330920-84330942 GAGAGAGAAACTGTTCATTTGGG + Intergenic
934740241 2:96715334-96715356 TACAGAGAATCTGTCTACTTCGG + Intronic
934870511 2:97860964-97860986 GAGAGAGAGTCTGTGCACTTGGG + Intronic
935750834 2:106232543-106232565 GAGAGAGAATCTGTGCACATTGG + Intergenic
935791417 2:106593924-106593946 AAGATCAAATCAGTGCACTTGGG + Intergenic
935835678 2:107050655-107050677 GAGAGAAAATCTCTGCACTTGGG - Intergenic
935989251 2:108704758-108704780 AAGAGAGAATCTGTGTGATTTGG + Intergenic
936641548 2:114317380-114317402 GAAAGACAATCTGTGCCCTTTGG - Intergenic
936925229 2:117730305-117730327 CAAAGAGAGTCTGTGCTCTTGGG + Intergenic
938486787 2:131719817-131719839 GAGAGAGACTCTGTGGGCTTGGG - Intergenic
939519648 2:143213565-143213587 AAGTGAGAATGTGTGCACAGTGG + Intronic
939692967 2:145288763-145288785 AAGACAGAACCTGTGAAATTAGG + Intergenic
939913013 2:148006150-148006172 GAGATAGAATCTGTGTGCTTGGG + Intronic
940012280 2:149067044-149067066 AAGAGAGAATATGTGGTATTTGG + Intronic
940880281 2:158940145-158940167 AAGATAGAATCCCAGCACTTTGG + Intergenic
941047648 2:160694764-160694786 GAGAGAGAGTCTGTGCATGTCGG - Intergenic
941357379 2:164510924-164510946 GAGAAAGAATCTGTGTACTTGGG + Intronic
941943279 2:171067138-171067160 ATCACAGAATATGTGCACTTAGG + Intronic
942391899 2:175503387-175503409 GAGAGAGAAACTGTGCACTTTGG - Intergenic
943067739 2:183106278-183106300 AAGAGAGAATGTGTGTGCTTGGG - Intergenic
944096058 2:195968956-195968978 GAGAGAGAATCTGTACACGTCGG - Intronic
944133385 2:196370853-196370875 GAGAGAGAATCTGTGCGCTTAGG - Intronic
944287343 2:197966571-197966593 AAGAGAGAATCTATGTGCCTGGG - Intronic
944550153 2:200838306-200838328 GAGAGATAATCTGTGAACTTGGG + Intergenic
944990652 2:205230963-205230985 CAGACAGAATCTGTGCACCTTGG - Intronic
945334318 2:208573466-208573488 AAGAGAGAATCTGTGTGCTTGGG + Intronic
945803852 2:214465956-214465978 GAGAAAGAATCTGTGTGCTTGGG - Intronic
946697209 2:222371874-222371896 CATAGAGAATCTGTGCACTGTGG + Intergenic
947131036 2:226924832-226924854 GACAGAGAATCTGTGTACTTGGG - Intronic
1169107273 20:3007234-3007256 AAGCGTGAGTCTGTGCACATAGG + Intronic
1169623817 20:7540175-7540197 GAGAGAGAATCTGTGTGCCTGGG + Intergenic
1170062307 20:12272012-12272034 AAGAGAGAATATGTGGTATTTGG + Intergenic
1170668258 20:18405861-18405883 GAAAGAGAATGTGTGCACTTTGG + Intronic
1174577415 20:51546393-51546415 AATAAATAATCTGTGCTCTTAGG + Intronic
1174690927 20:52503788-52503810 GAGAGAGCATCTGTGCACTTGGG + Intergenic
1175632275 20:60551232-60551254 GAGACAGAATCTGTGTGCTTGGG - Intergenic
1176940066 21:14912662-14912684 GAGAGAGAATCTGTGCACGTTGG - Intergenic
1177137207 21:17318224-17318246 TAGAAAGAATTTGTGCACTTGGG + Intergenic
1177212760 21:18091017-18091039 CAGAGAGACTCTGCTCACTTTGG + Intronic
1177222337 21:18210316-18210338 GAGAGAGAATCTGTGCACATCGG - Intronic
1177276092 21:18914221-18914243 GAAAGAGAATCTGAGCACTTAGG - Intergenic
1177494703 21:21873533-21873555 GAAAGAGAATCTGTGTGCTTGGG - Intergenic
1177539730 21:22477084-22477106 GAGAGAGAATCTGTGTGTTTTGG + Intergenic
1177771187 21:25518540-25518562 GAGAAAGAATCTGTGTGCTTGGG + Intergenic
1177969904 21:27777034-27777056 CACAGAGAATCTGTGCACTTGGG + Intergenic
1178489958 21:33043337-33043359 AAGAGAAAGGCTGTGGACTTGGG + Intergenic
1180490990 22:15848704-15848726 GAGAGAGACTCTGTGTTCTTGGG - Intergenic
949623102 3:5838040-5838062 GAGAGAGAATCTGTGTGCTTGGG - Intergenic
949688324 3:6604001-6604023 AAGAGAGTATCTGTATTCTTAGG - Intergenic
950190538 3:10973483-10973505 AGGACAGAAGCTGTGCATTTTGG - Intergenic
950374671 3:12561274-12561296 AAGAGATAATTAGTGCAGTTTGG + Intronic
950801203 3:15552999-15553021 TGGAGAGAATCTGTGCATTTAGG - Intergenic
951125965 3:18983409-18983431 AAGAGAGAATCTGTATGCTTGGG - Intergenic
951255044 3:20439025-20439047 GAGAGAGAATCTGTTCATTTGGG + Intergenic
951260024 3:20496245-20496267 GAAATAGAATCTGTGTACTTTGG - Intergenic
951393080 3:22130636-22130658 AAGAGAGAATCTGTGCTCTTGGG - Intronic
951398609 3:22202724-22202746 GACAGAGAATCTGTGAGCTTGGG + Intronic
951437101 3:22677213-22677235 GAGAGAGAATCTGTGTGCTTGGG - Intergenic
951492578 3:23288887-23288909 AAGAGAGAATATGTATTCTTGGG - Intronic
951495171 3:23317413-23317435 GAGAGACAATCTGTGCACTTGGG - Intronic
952318897 3:32257827-32257849 AAGTGAGAATCTCTGTACCTCGG + Intronic
952645943 3:35659058-35659080 AAGAGAGAATATGTGCTGTGTGG - Intronic
952833070 3:37581489-37581511 AAGAGAGAATGCGTGTTCTTAGG + Intronic
953195077 3:40724494-40724516 AACAGTGAATCTGTCCTCTTTGG - Intergenic
953362518 3:42310304-42310326 GAGAGAGAACCTGTGCCCTTTGG - Intergenic
953491254 3:43353932-43353954 AAAAGAAAATCTGTGGTCTTTGG - Intronic
954491484 3:50910734-50910756 GAGAGACAATCTGTGTACTTGGG - Intronic
955274497 3:57534190-57534212 GAGAGAGAATCTGTGCACTTGGG - Intronic
955389890 3:58514086-58514108 AATAGAGGATCTGTGGACTAGGG - Intronic
956222763 3:66922260-66922282 GAGAGAGAATCAGTGCACTTTGG + Intergenic
956549379 3:70441336-70441358 GAGAGAGAATCTGTACATGTAGG + Intergenic
956887748 3:73577674-73577696 AAGACAGGAGCTGTGCACTCTGG - Intronic
957211683 3:77267211-77267233 TAGAGAGAACCTTTGAACTTGGG - Intronic
957852748 3:85831073-85831095 AAGAGAGAACCTGTGGTATTTGG + Intronic
957976232 3:87448214-87448236 GAGAGATAATCTGAGTACTTGGG - Intergenic
957977083 3:87460553-87460575 GAGAGAGAATCTGTGTGCTTAGG + Intergenic
958099280 3:88988514-88988536 CAGAGAAAATCTGTGCACTCAGG + Intergenic
958670526 3:97198001-97198023 GAGAGAGAATCTGTGTGTTTGGG - Intronic
958765992 3:98368360-98368382 GAGAGACAATCTGTGTGCTTGGG - Intergenic
959126064 3:102291350-102291372 GAGAGAGAATCTGTGCACTTAGG - Intronic
959127407 3:102307184-102307206 AAGAGACAATCTGTGTGCTTCGG + Intronic
959189961 3:103098209-103098231 GAGAGAGAATCTGTGCATTTGGG - Intergenic
959409157 3:105998424-105998446 TAGACAGAATCTGTGTCCTTGGG - Intergenic
959421207 3:106131325-106131347 AAGAAAGTCTCTGTGCACTCTGG - Intergenic
959474236 3:106790151-106790173 TGCAGAGAATCTGTGCAATTGGG + Intergenic
959737426 3:109675999-109676021 AATAGAGAATCTAGGCAGTTGGG - Intergenic
959752079 3:109849885-109849907 GAGAGAGACACTGTCCACTTGGG + Intergenic
959841515 3:110982248-110982270 TAGGCAGAATCTGTGCACCTGGG + Intergenic
959868581 3:111300377-111300399 TAGATAGAATTTGTGCACTTAGG - Intronic
960067197 3:113386858-113386880 AAGAGATAATCTGGGTACTTGGG + Intronic
960354058 3:116629269-116629291 TAGAGAGAATCTGTATGCTTGGG - Intronic
960404024 3:117238037-117238059 GAGAAAGAATCTGTGTGCTTGGG + Intergenic
960425349 3:117500323-117500345 AAGTGAGTATATATGCACTTTGG - Intergenic
960429669 3:117553579-117553601 AAGAGACAATTGGTTCACTTTGG - Intergenic
960471953 3:118076400-118076422 GAGAGAGAATCTGTGTGCTTAGG - Intergenic
960564808 3:119122220-119122242 CATGGAAAATCTGTGCACTTGGG + Intronic
960765179 3:121119624-121119646 AAAAAAGCATCTGTGGACTTTGG - Intronic
960801979 3:121549017-121549039 AGGACAGAAACTGTGCATTTGGG + Intergenic
960869896 3:122238226-122238248 AAGAGAAAATCTGTGCATTTTGG + Intronic
962767469 3:138579052-138579074 GAGAGAGAATCTGTGCACTTAGG + Intronic
963154016 3:142077018-142077040 AAGAGAGAATCTATGCACCTGGG + Intronic
963219681 3:142795196-142795218 AAAAGAGTATCTGTGAACTTTGG + Intronic
963701277 3:148629961-148629983 GAGAGAGAATCTGTGTGCTTGGG + Intergenic
964021672 3:152021051-152021073 CAGAGAGAATCTGTGCACTTGGG + Intergenic
964085792 3:152816560-152816582 AGGAGAGAAGCTGGGCACTATGG - Intergenic
964140891 3:153397480-153397502 GCGAGAAAATCTGTGCACTTAGG - Intergenic
964151556 3:153531728-153531750 GAGAGAGAATATGTGCACTTAGG + Intergenic
964197817 3:154084938-154084960 ATGTGAGCATCTGTGAACTTTGG - Intergenic
964259041 3:154812416-154812438 GGAAGAGAATCTGTGCACTTGGG - Intergenic
964583014 3:158260891-158260913 GAGACAGAATCTGTGCACTTGGG - Intronic
964961045 3:162427319-162427341 GAGAGAGAATCTGCGTGCTTAGG + Intergenic
964992180 3:162827971-162827993 AAGAGAGAATCTGTGCCCTTGGG + Intergenic
965034580 3:163422525-163422547 GAGAGATAATCTGTGTACTGGGG + Intergenic
965253051 3:166368016-166368038 GAGAGAGAATTTGTGCACTTGGG + Intergenic
965256979 3:166425726-166425748 GAAAGAGAATCTATGCACTTGGG + Intergenic
965322384 3:167265918-167265940 GAGAGAGAATCTGTGCTCTCTGG - Intronic
965358596 3:167709406-167709428 GACAAAGAATATGTGCACTTGGG + Intronic
965379137 3:167966750-167966772 GAGAGAGAATCTGTGTGCTTGGG + Intergenic
965415306 3:168385186-168385208 CAGAGAGAGTCTGTGCTCTTGGG - Intergenic
965472567 3:169113465-169113487 GAGAGAGAATATATGCTCTTTGG + Intronic
965775144 3:172221716-172221738 AAGAGATAATGTAGGCACTTTGG - Intronic
966141824 3:176766274-176766296 GAGAGAGAATCTGTGTGCTTGGG + Intergenic
966454112 3:180095082-180095104 GAGAGAGAATCTGTACACAGGGG - Intergenic
967555770 3:190855829-190855851 AGGAGAGTATCTTTGCTCTTTGG + Exonic
967608828 3:191481029-191481051 GAGAAAGAATCTGTGCACTTGGG + Intergenic
967983601 3:195079804-195079826 AAGAGAGAATCTGTTTACAAGGG + Intronic
968646698 4:1744652-1744674 GAGGGAGAATCTGAGCACCTGGG + Intronic
970085377 4:12340352-12340374 AAGTGAGAATATGTGGAGTTTGG - Intergenic
970098080 4:12487472-12487494 AAGAGAGAAACTGTGCATTTGGG - Intergenic
972115057 4:35621301-35621323 AAGAGAGAACATGTGCTGTTGGG - Intergenic
972125405 4:35758956-35758978 GAAAGAAAATCTGTGCACTTTGG - Intergenic
972941632 4:44202535-44202557 AAGTGAGAATATGTGGAATTTGG - Intronic
972989562 4:44807327-44807349 AAGATCAAATCTGTGTACTTGGG + Intergenic
973327544 4:48878609-48878631 GAGAGAAAATCTGTGTGCTTGGG - Intergenic
973852654 4:54976734-54976756 GAGGGAGAATCTGTGCACTTTGG + Intergenic
974224364 4:59019252-59019274 CAGAGAGAATCTGTGTGCTTGGG - Intergenic
974266899 4:59597680-59597702 CAGACAGAATCTGTGTGCTTGGG + Intergenic
974290613 4:59925438-59925460 CAGAGAGAATCTATGCCTTTGGG + Intergenic
974415087 4:61595984-61596006 GAGAGAGTATTTGTGCACTTTGG - Intronic
974747369 4:66092947-66092969 AAGAGAGATTCTTTGCTATTGGG - Intergenic
974868061 4:67604197-67604219 GAGAGAGAATCTGTGTGCTTAGG - Intronic
975040127 4:69736021-69736043 TGGTGAGAATCTGTGCACTTGGG + Intronic
975314347 4:72933924-72933946 GAGAGAGAATCTGTGTATTTAGG - Intergenic
975369600 4:73569074-73569096 TGTGGAGAATCTGTGCACTTGGG - Intergenic
975376062 4:73646797-73646819 AAGAGAGAATCTATGATCTTAGG - Intergenic
976728616 4:88240719-88240741 GAGAGAGAATCTGTGCACTTGGG - Intergenic
976908186 4:90266641-90266663 GAGAGAGAATCTGTGCTTCTGGG + Intronic
976981949 4:91243074-91243096 GAGAGAGAATCTGTGTACTTTGG + Intronic
977307327 4:95341828-95341850 GAGAGAGAATCTGTGTCCTTGGG + Intronic
977325808 4:95573107-95573129 CACAGAGAACCTGTACACTTGGG - Intergenic
977381123 4:96274875-96274897 CACAGAGAATCTGTGTGCTTGGG - Intergenic
977952703 4:102992913-102992935 AAGAGAGAATGAGTGCAAGTAGG + Intronic
978008775 4:103652402-103652424 GAGAGAGAATCTTTGCCCTTGGG - Intronic
978049620 4:104181733-104181755 AAGAGGGAATCTTTGCACACTGG + Intergenic
978733680 4:112061301-112061323 GAGAGAGAATCTGTGCATTTGGG + Intergenic
979142819 4:117200500-117200522 GAGAAAGAATCTATGAACTTGGG + Intergenic
979396619 4:120197184-120197206 GAGAGAGAATCTGTGCACTTTGG + Intergenic
979945720 4:126829510-126829532 CAGAGAGAATCTGTGTGCTTGGG + Intergenic
980172533 4:129306642-129306664 AAGAGAGAATCTGTGCACTTTGG - Intergenic
980398793 4:132252096-132252118 AACAGAGAATCTTTGGACTGTGG + Intergenic
980442422 4:132866697-132866719 CACAGAGAATCTGTGCACTTGGG + Intergenic
980538281 4:134159469-134159491 CAAAGAGAATCTGTGTGCTTTGG + Intergenic
980596822 4:134965893-134965915 GAGAGAGAATCTGTGTGCTTGGG + Intergenic
980620183 4:135291250-135291272 AAGAACAAATCAGTGCACTTGGG + Intergenic
980682798 4:136186529-136186551 GAGAAAGAATCTCTGTACTTGGG + Intergenic
980712634 4:136590646-136590668 GTGGGAGAATCTGTGCATTTAGG + Intergenic
980752906 4:137115727-137115749 GAGGGAGAATCTGTGTTCTTGGG + Intergenic
980800124 4:137736046-137736068 GAGAGACAATCTGTGTGCTTGGG - Intergenic
981140116 4:141258652-141258674 GAGAGAGAATCTCTGCACTTAGG + Intergenic
982339718 4:154284564-154284586 GAGAGAGAATCTGTGCACTTGGG + Intronic
982567908 4:157009680-157009702 AAGTGAGAATCTGTACAGTTTGG - Intergenic
982622661 4:157727039-157727061 CAGAGAGAATCTGTATGCTTAGG + Intergenic
982683493 4:158459967-158459989 GAGAGAGAATCTGTGCACTTTGG - Intronic
982719636 4:158846956-158846978 GAAAGGGAATCTGTGCACTTGGG + Intronic
982828409 4:160028299-160028321 GGGAGAGAGTCTGTGCACTTGGG - Intergenic
983166071 4:164478387-164478409 GAGAGAGAATTTGTGTGCTTGGG - Intergenic
983265902 4:165507791-165507813 AAGAGAAAATCTATGCTGTTTGG - Intergenic
984215662 4:176910472-176910494 ATGAGAGAACCTGTACACTTTGG - Intergenic
984317589 4:178146530-178146552 AAGAGAAATTCTGTGTATTTTGG - Intergenic
984371392 4:178871168-178871190 TAGAGAAAATCTGTTCAGTTGGG - Intergenic
984550446 4:181152925-181152947 AAGTGAGAACCTGTGCTGTTTGG + Intergenic
984915478 4:184719320-184719342 CACAGAGAATCTGTGCTCTTGGG + Intronic
985152106 4:186958118-186958140 AAGGGAGAATCTGGGCTCTGTGG - Intergenic
985245423 4:187975704-187975726 AAGTGAGAATATGTGCTATTTGG - Intergenic
986631310 5:9776271-9776293 GAGAGAGAATCCATGCACTTGGG - Intergenic
986756210 5:10839056-10839078 CATGGAGAATCTGTGCATTTAGG + Intergenic
987066553 5:14295692-14295714 AAGAGAGAAAGAATGCACTTGGG + Intronic
987564177 5:19563893-19563915 AAGAGAGAATCTGTGCACTTTGG + Intronic
987596886 5:20012811-20012833 AAGTGAGAATGTGTGGAATTTGG - Intronic
987675691 5:21070230-21070252 AAGAGGGGATCTGTTCACTTGGG - Intergenic
987886178 5:23815879-23815901 GGGAGAGAATCTGTGTGCTTGGG + Intergenic
988064578 5:26218325-26218347 GAGAGAGAATCTGTGTGCTGGGG + Intergenic
988265434 5:28942691-28942713 GAGAGAAAATCTGTGTCCTTGGG - Intergenic
988563313 5:32300102-32300124 AAGAAACAGTCTGTGCACTCAGG - Intronic
988931588 5:36040511-36040533 GAGACAGAATCTGTGTGCTTAGG + Intronic
989579663 5:43020049-43020071 CAGAGAGAAACCGTGCTCTTGGG - Intergenic
990202969 5:53398336-53398358 CATGGAGAATCTGTGCGCTTGGG - Intergenic
990531291 5:56675902-56675924 GAGAGAGAAACTGTGCAGTGTGG - Intergenic
991185605 5:63803217-63803239 AAGGGAGAAACTGTTCATTTTGG - Intergenic
991237573 5:64417474-64417496 GAGAGAGAATCTGTGCACTTCGG + Intergenic
991420165 5:66432571-66432593 AAGATAAAATCAGTGCACTTAGG + Intergenic
991659999 5:68941700-68941722 AAGTGAGAATATGTGCTGTTTGG - Intergenic
992657106 5:78921884-78921906 GAGACAGAATCTGTGTTCTTGGG + Intronic
993026566 5:82653805-82653827 CAAAGAGAATCTATGCACTTAGG - Intergenic
993171140 5:84420207-84420229 GAGAGATAATCTGTGCACTTGGG - Intergenic
993205668 5:84875447-84875469 GAGAGAGTATCTGTGCATTTAGG + Intergenic
993207162 5:84896029-84896051 AAGAGAGAATCTTTGCACTTTGG - Intergenic
993256975 5:85604446-85604468 GAGAGAGAATCTGTGTCCTTGGG + Intergenic
993275882 5:85858133-85858155 AAGAGAGAATATGTGGTGTTTGG - Intergenic
993932321 5:93954982-93955004 GAGAGAGAATCTGTGCATTTGGG - Intronic
994226042 5:97253146-97253168 GACAGAGAATCAGTGCACTTTGG + Intergenic
994233782 5:97338708-97338730 GAGAGAAAATCTGTGCCTTTGGG + Intergenic
994592848 5:101793330-101793352 AAGTGAGAATCTGTGGTGTTTGG + Intergenic
994765770 5:103915495-103915517 AAGAGAAAATAAGTGCACTCAGG - Intergenic
994881196 5:105498577-105498599 GGGAGACAGTCTGTGCACTTTGG - Intergenic
994951089 5:106464087-106464109 ATGAGAGAATATGTGGACTCAGG - Intergenic
995265178 5:110151814-110151836 GAGAGAGAATCTGTGTACTTTGG + Intergenic
995268747 5:110195754-110195776 GAGAGAGAATCTGTGCACTCAGG - Intergenic
995697913 5:114900414-114900436 TGGAGAGAATCTGTGTGCTTGGG - Intergenic
995770501 5:115664528-115664550 GAGAGAGGATCTGTGGGCTTGGG + Intergenic
996210030 5:120797775-120797797 CAGAGAGAATCTGTGCCATTGGG + Intergenic
996944906 5:129055383-129055405 GAGAGAGAATCTGTGCATTTAGG + Intergenic
996956288 5:129187078-129187100 GAGAGAGAATCTGTGTGCCTTGG + Intergenic
997104505 5:131003899-131003921 AAGAGAGAATCTGTGTGCTTGGG + Intergenic
997486320 5:134233967-134233989 AAGAGAGAATGAGTGTATTTAGG - Intergenic
997712686 5:136019094-136019116 TAGAGAAAAGATGTGCACTTAGG - Intergenic
998410321 5:141905317-141905339 AAGAAAGAAGCTGGGCACTGTGG + Intergenic
998633916 5:143931456-143931478 GTGAGAGAATCTGTGCACTTTGG + Intergenic
998872798 5:146569287-146569309 GAGAGAGAATGTGAGCACATGGG - Intergenic
999110845 5:149120280-149120302 AAGAGAGAATGTGTGATATTTGG - Intergenic
999135263 5:149314522-149314544 AAGAGGTAATATGAGCACTTTGG - Intronic
999497563 5:152114978-152115000 AAGAAAGAAGCTATGCACTAAGG - Intergenic
999667306 5:153926727-153926749 GAGAGAGAATCCATGCACTTGGG + Intergenic
999849604 5:155523925-155523947 GAGAGAGAACCTGTGTGCTTGGG - Intergenic
1000120359 5:158191786-158191808 AAGAGAGAAAATGTGAACTAAGG - Intergenic
1000433405 5:161179285-161179307 GAGAGAGAATCTATGCTGTTGGG + Intergenic
1000628925 5:163569896-163569918 AGGAGAGAATCTGTGCTGTGTGG + Intergenic
1001614288 5:173030047-173030069 AAGAGAGAATGGGTGAACTGAGG - Intronic
1001845249 5:174916420-174916442 CAGAGAGAATCTACGCACTTGGG + Intergenic
1002009880 5:176270644-176270666 GAGAGAGAATCTGTGTGCTTGGG + Intronic
1002216846 5:177641664-177641686 GAGAGAGAATCTGTGTGCTTGGG - Intergenic
1004363933 6:14996337-14996359 AAGAGAAAATCCCAGCACTTTGG + Intergenic
1005200065 6:23334709-23334731 AAGAGAGAAACTGTGGCCCTTGG - Intergenic
1005279889 6:24262156-24262178 GAGAGAGAATCTGTGTGCTTAGG + Intronic
1007001776 6:38320105-38320127 GAGAGAGAATCCGTGCATTTGGG - Intronic
1007022205 6:38532108-38532130 GAGAAGGAATCTGTGCAATTAGG + Intronic
1008086243 6:47247778-47247800 AACAGAGCATTTGTGCACTTAGG - Intronic
1008192261 6:48474813-48474835 GAGAAAGAATCTGTACACTCCGG + Intergenic
1008289360 6:49694567-49694589 GAGAGAGACACTGTCCACTTGGG - Intronic
1008683456 6:53899100-53899122 AAGAGAGAAAGCTTGCACTTTGG + Intronic
1008707666 6:54182343-54182365 CACAGAGAGTCTGTGCACTTGGG - Intronic
1008759808 6:54840209-54840231 CAGAGAGAAGCTCTGAACTTAGG + Intergenic
1008822653 6:55651920-55651942 AAGAGAGAATCTGTGCACTTTGG - Intergenic
1009039466 6:58159127-58159149 GAGACAAAATCTGTGCATTTGGG - Intergenic
1009215358 6:60913967-60913989 GAGACAAAATCTGTGCATTTGGG - Intergenic
1009373635 6:62939399-62939421 GAAAGAGAATCTGTACACCTAGG - Intergenic
1009473096 6:64052804-64052826 AAGAGAGAATGAGTGCAAGTGGG - Intronic
1010343124 6:74780785-74780807 GAAAGAGAATCTGTGTGCTTGGG + Intergenic
1010839496 6:80631674-80631696 AAGAGAACGTCTATGCACTTTGG + Intergenic
1011772905 6:90694658-90694680 AAGAGACAATGAGTGCAGTTTGG + Intergenic
1011837324 6:91449563-91449585 GATAGAGAATCTGCGGACTTTGG - Intergenic
1012028512 6:94028944-94028966 AAGAGAGAATCTGTGCACTTGGG + Intergenic
1012047719 6:94300378-94300400 AAGAGAAAATTTGTGTGCTTGGG + Intergenic
1012057118 6:94427177-94427199 CAGAGAGAATCTGTGTGCTTGGG - Intergenic
1012059774 6:94463445-94463467 AAGAGAGAATCATTTTACTTAGG - Intergenic
1012244139 6:96907665-96907687 AAGAGTGACTCTGTGATCTTAGG + Intergenic
1012618370 6:101306426-101306448 AAGTGAGAATATGTGAAATTTGG - Intergenic
1012715198 6:102660362-102660384 GAGAGAGAATCTGTTCACCTCGG + Intergenic
1012813822 6:103996409-103996431 AGGAGAGAATCTGTGTCCTTTGG - Intergenic
1012892001 6:104907552-104907574 AAGAGAGAATCCGTGCGTTTGGG + Intergenic
1014234511 6:118939567-118939589 GAGAGAGAATCTGTGCACTTGGG + Intergenic
1014378647 6:120711132-120711154 AAGAGAGAATCTGTGCACTTGGG + Intergenic
1015052931 6:128863682-128863704 GAGAGAGAATCTGCGTTCTTTGG - Intergenic
1015392781 6:132701823-132701845 GAGAGAAAATTTGTGCCCTTGGG + Intronic
1015460590 6:133487061-133487083 GAGAGAGAATCTGTGCACTTGGG + Intronic
1015799126 6:137043392-137043414 AAGAGAGAAGCTGGGCGCTGTGG - Intronic
1016115862 6:140285193-140285215 AAAAGAAAATTTGTTCACTTTGG + Intergenic
1016194516 6:141317527-141317549 GAGAGAGAATCTGTGCCCTTGGG + Intergenic
1016228579 6:141772727-141772749 CATGGAGAATTTGTGCACTTGGG - Intergenic
1016303586 6:142658463-142658485 AAGTGAGAACATGTGCTCTTTGG + Intergenic
1016541372 6:145169943-145169965 GAGAGAGAATCTGTGTGCTTGGG + Intergenic
1017924853 6:158901852-158901874 GAGAGATGATCTGTGCACTTTGG - Intronic
1018696309 6:166394185-166394207 CAGAGAGAATCTGTGTGCTTGGG + Intergenic
1019066298 6:169302181-169302203 GAGAGACAATCTGTGTGCTTGGG + Intergenic
1019623816 7:2005393-2005415 AACTTACAATCTGTGCACTTTGG + Intronic
1020422636 7:8026593-8026615 AGCACAGAATCTGTGCACTTTGG + Intronic
1020577086 7:9947085-9947107 CAGAGAAAATCTGTGTGCTTTGG + Intergenic
1021214746 7:17901634-17901656 GAGAGAAAATCTGTGCACTTAGG - Intronic
1021831497 7:24617126-24617148 AAGAAAGAATTTCTGAACTTAGG - Intronic
1021922975 7:25505688-25505710 GAGAAAGAATCTGTGCACTTGGG + Intergenic
1022667364 7:32424372-32424394 AAGAGAGAAACTGTCACCTTGGG - Intergenic
1023782855 7:43673901-43673923 AAGAGAGAACCTGTGGTATTTGG - Intronic
1023976361 7:45033206-45033228 AAGAGAGACCCTCTGCAGTTAGG - Intronic
1024170175 7:46777292-46777314 GAGAGAGAATATGTCCACTTGGG + Intergenic
1024288968 7:47786571-47786593 AGGAGAGACTCTGTGCCCTGAGG + Intronic
1024369229 7:48560348-48560370 GAGAGGGAATCTGTGCACTTGGG - Intronic
1024404256 7:48960245-48960267 ATGAGAAAAACTGTGCCCTTAGG + Intergenic
1024662535 7:51511838-51511860 TAGAAAGAATCTGTGAAATTGGG - Intergenic
1024705963 7:51959810-51959832 GAGGCAGAATCTGTGCACTTTGG - Intergenic
1024810042 7:53199409-53199431 ATGAAAGAATATGTGCACTAGGG - Intergenic
1025061530 7:55812823-55812845 GAGAGAGAATCTGTGTGTTTTGG + Intronic
1025718743 7:63989567-63989589 AAGAGAGAATCTGGGCGCGGTGG + Intergenic
1025862072 7:65339514-65339536 AAGAGAGAATTTGTGTGCTTAGG - Intergenic
1026839700 7:73663158-73663180 AAGACAGAATCAGTTCATTTTGG - Intergenic
1027258207 7:76444770-76444792 ATGGGAGAATCTGTGCCCTGGGG + Intergenic
1027280641 7:76607249-76607271 ATGGGAGAATCTGTGCCCTGGGG - Intergenic
1027605002 7:80288779-80288801 GAGAGAAATTCTGTGTACTTTGG + Intergenic
1027921281 7:84399101-84399123 AAAAGAGAATCTGTGTGCTTGGG + Intronic
1028207666 7:88034844-88034866 GAGAGAGAAACTGTGCACTTAGG - Intronic
1028247992 7:88505735-88505757 GAGAGAAAATCTGTGTATTTGGG - Intergenic
1028266705 7:88734330-88734352 GAATCAGAATCTGTGCACTTAGG - Intergenic
1028299664 7:89181521-89181543 AAGAAATAATCTGTGTGCTTGGG - Intronic
1028353524 7:89879039-89879061 GAGAGAGAATCTGTGTGCTTGGG - Intergenic
1028868185 7:95737117-95737139 GAGAGAAAATTTGTGCCCTTGGG - Intergenic
1029042615 7:97593420-97593442 GAGAAAGAATCTGTGCACTTTGG - Intergenic
1030274499 7:107705584-107705606 AAGGAAGCATCTGTGCAGTTGGG - Intronic
1030628657 7:111871315-111871337 AAGAGAGAAGCTGTGGCCTCTGG + Intronic
1030966186 7:115995751-115995773 GAGAGAGTATCTGTGCTCTTGGG + Intronic
1031215321 7:118883069-118883091 GAGAGAGAATTTGTGCGCTTTGG + Intergenic
1031306144 7:120130295-120130317 GAGAGAAAATCTGTGCACTTGGG + Intergenic
1031353587 7:120763910-120763932 CAGAGAGAATCTGTGTATTTAGG - Intergenic
1031565832 7:123296148-123296170 GAGAGAGAATCTGTATGCTTGGG + Intergenic
1031657731 7:124379427-124379449 GAGAGATAATCTGTGCACTTTGG + Intergenic
1031721805 7:125186620-125186642 GAGAGAGAATCTCTGTGCTTGGG + Intergenic
1031862190 7:126993649-126993671 GAAAGAGAATCTGTACACTTGGG + Intronic
1032630924 7:133650873-133650895 TAGAGAGAAGCTGTTCATTTAGG + Intronic
1032942345 7:136809758-136809780 GAGAGAGAATCTGTGCACTTGGG + Intergenic
1033542478 7:142369630-142369652 GAGAGACAGTCTGTGCATTTGGG - Intergenic
1033722199 7:144073291-144073313 AAGATCAAATCTGTGTACTTGGG - Intergenic
1033867904 7:145714716-145714738 GAGAGACAATCTGTGCTCTTGGG - Intergenic
1033879308 7:145862057-145862079 ATGAGAGAATCTGGACACCTTGG - Intergenic
1033967947 7:147001067-147001089 GAGAGAGACACTGTTCACTTGGG - Intronic
1035138972 7:156738150-156738172 GAGAGAGAATCTGTGTACTTGGG + Intronic
1035625680 8:1068892-1068914 AAAAGGGAATCTGTGAACCTGGG + Intergenic
1036464126 8:8980415-8980437 AACAGAGATTCTGTGCACGGTGG - Intergenic
1036814937 8:11895040-11895062 AAGAGAGAATCTGTGTGCTTGGG - Intergenic
1036941681 8:13058149-13058171 AAGAGAGAAACTATGCTCTCTGG + Intergenic
1037157512 8:15722484-15722506 AAGAGAGAAACTGAGCCTTTTGG - Intronic
1037254735 8:16941109-16941131 AAGAAAGACTATGTGCACTTTGG + Intergenic
1039323106 8:36454478-36454500 AAGAGAGGACCTCTGCACTCAGG + Intergenic
1039644748 8:39268671-39268693 AGGAGAAAATCTGTGAACTTGGG - Intronic
1039785654 8:40832277-40832299 AAAAGAGAGTCTGAGCACTGAGG - Intronic
1040485610 8:47868843-47868865 GACACAGAAGCTGTGCACTTGGG + Intronic
1040664468 8:49616389-49616411 AAGACAAACTCTGTGAACTTGGG + Intergenic
1040721108 8:50324295-50324317 GAGACAGAATCTGTGCATCTTGG - Intronic
1040743242 8:50605568-50605590 AAGAGAGAATCTGTGCACTTGGG - Intronic
1040745525 8:50636591-50636613 AGGAGAGAATCTGTGCTCTTTGG - Intronic
1041207408 8:55512505-55512527 AAGAGAGAACCCGTGTACTAAGG - Intronic
1041305388 8:56452222-56452244 AGGAAAGAATCTCTGGACTTGGG + Intergenic
1041580021 8:59447698-59447720 GAGAGAGAATCTGTGCACTTTGG - Intergenic
1041582966 8:59483870-59483892 GAGAAAGAATCTGTGCACTTCGG - Intergenic
1041606820 8:59792010-59792032 GAGAGAGAATCTGTCTGCTTGGG + Intergenic
1041640483 8:60194535-60194557 AAGAGAGAGACTCTGTACTTGGG - Intronic
1041744886 8:61197903-61197925 CAGGAAGAGTCTGTGCACTTTGG - Intronic
1041850854 8:62390279-62390301 AAGTGAGAATCTGTGTTCTTTGG + Intronic
1042032445 8:64491151-64491173 GAGAGAGAATCTGTCCACTTTGG + Intergenic
1042034725 8:64519595-64519617 AAGAGAGAAACTCTGCACTTAGG - Intergenic
1042082669 8:65071959-65071981 GAGAGATAATCTATGCTCTTGGG - Intergenic
1042162515 8:65911795-65911817 GAGAGAAAATCTGTGTGCTTGGG + Intergenic
1042297820 8:67241882-67241904 GAGAGAAAATCTGTGTACTTGGG + Intronic
1042428068 8:68672436-68672458 AAGAGAGAATCTGTGGGCTTAGG + Intronic
1043041966 8:75275197-75275219 AAGAGAGAATCTGTGCACCTGGG + Intergenic
1043226913 8:77745176-77745198 CAGAGATAATCTGTGGGCTTAGG + Intergenic
1043403428 8:79906229-79906251 AAGAGATAATCTCTGCTCCTTGG - Intergenic
1043600218 8:81928593-81928615 GGGAGAGAATCTGTGTACTCTGG + Intergenic
1044066141 8:87702817-87702839 AAGAGAGAATGTTTGCCCTTAGG + Intergenic
1044104192 8:88182066-88182088 AAGAGAAAATCTAGGGACTTTGG + Intronic
1044124159 8:88437317-88437339 AAGAGAGAATCTGTGCACTTAGG + Intergenic
1044635555 8:94320230-94320252 GAGAGAGAATCTGTGTGCTCAGG - Intergenic
1045578522 8:103452319-103452341 TAGAGATAAACTGTGCCCTTTGG + Intergenic
1045592606 8:103614366-103614388 AGCACAGAGTCTGTGCACTTAGG - Intronic
1046463486 8:114571809-114571831 AAGAGAGAATCTGTGCTTTTGGG - Intergenic
1046604525 8:116356182-116356204 AAGAGACAATTTCTGCCCTTAGG + Intergenic
1046811548 8:118538583-118538605 GAGAGAGAATCTGTGCCCTTTGG - Intronic
1047138489 8:122107902-122107924 GAGTGAGAATCTGTGCACCTGGG - Intergenic
1047342935 8:124000201-124000223 GAAAGAAAATCTGAGCACTTGGG - Intronic
1047352544 8:124089336-124089358 GAGAGAGGATCTGTGCACTTAGG - Intronic
1048490272 8:134885575-134885597 AAGACAGAGGCTGTGCAGTTGGG + Intergenic
1048680402 8:136834687-136834709 AAGAAAGAATTCGTGAACTTTGG - Intergenic
1050030696 9:1382284-1382306 AAGGCAGAATATGTGCACTGAGG + Intergenic
1050248055 9:3712980-3713002 GAGAGAGAATCTGTGCACTTTGG + Intergenic
1050355644 9:4780566-4780588 TGCAGAGAATCTGTGCATTTGGG + Intergenic
1050930281 9:11313468-11313490 AAGAGAGAATCTGAATACTTGGG - Intergenic
1050970284 9:11862495-11862517 AAAATAAAATCTGTGCACTGAGG + Intergenic
1051047079 9:12888213-12888235 CACAGAGAGTCTGTGCACTTGGG + Intergenic
1051229916 9:14945354-14945376 CACTGAGAATCTGTGCTCTTGGG + Intergenic
1051306613 9:15717156-15717178 TGGGGGGAATCTGTGCACTTGGG + Intronic
1051446289 9:17142651-17142673 TCGAGTGAATCTGTGCACTCTGG - Intronic
1051469710 9:17423833-17423855 GAGAGAGAATCTGTGTGCTTGGG - Intronic
1051842461 9:21414012-21414034 CATGGAGAATCTGTGCACTTGGG - Intronic
1052093877 9:24361708-24361730 GAGAGAGAATTTGTGCTCTTGGG + Intergenic
1052205024 9:25828542-25828564 GAGAGAGAATCTGTGCACTTTGG - Intergenic
1052420356 9:28235177-28235199 GAGAGAGAATCTCTACATTTGGG + Intronic
1052450606 9:28625309-28625331 GAGAGAGAATCTGTGCACTTGGG - Intronic
1052649035 9:31275745-31275767 AAGAGGGGATCTGTTCAGTTAGG + Intergenic
1052842672 9:33306435-33306457 AAGAGAGAAAATGTGGATTTGGG + Intronic
1054702149 9:68423615-68423637 GAGAGAGATTTTGTGCTCTTGGG - Intronic
1054982458 9:71222732-71222754 GAAAGAGAATCTGTGTGCTTGGG + Intronic
1055227260 9:74014540-74014562 GAGAGAGAATCTATGTACTTGGG + Intergenic
1055580088 9:77699107-77699129 CATGGAGAATCTGTGCACTTGGG - Intergenic
1055826909 9:80338484-80338506 GAGAGAGAATCTGTGTGCTTGGG + Intergenic
1055910957 9:81350624-81350646 GAGAGAGAATCTGTGCACTTTGG + Intergenic
1056230699 9:84539753-84539775 GAGAGAGAATCTGTGCAACTTGG - Intergenic
1056516663 9:87358774-87358796 CAGAGAGAATCTGTGTGCTTGGG + Intergenic
1056741600 9:89261104-89261126 AAGAGAGATTCTGAGCGCGTAGG - Intergenic
1056802157 9:89699849-89699871 AGGAGAGAAAGTGTGGACTTGGG - Intergenic
1057084505 9:92196661-92196683 AAGAGAGAATCTATGTTCTTGGG + Intergenic
1057289190 9:93789639-93789661 CATGGAGAATCTGTGCACTTAGG - Intergenic
1057346699 9:94258125-94258147 GAGAGAGAATCTATGTTCTTGGG + Intergenic
1058290677 9:103237267-103237289 AAGTGAGAAAATGTGCTCTTTGG - Intergenic
1058522923 9:105829467-105829489 GAGACAGAATCTGTGAACTTGGG - Intergenic
1060328581 9:122643278-122643300 GAGAGAGAATATGTGCACTGTGG + Intergenic
1186602265 X:11050328-11050350 GAAAGAGAATCTGTGCACTTGGG - Intergenic
1187575131 X:20546020-20546042 GAGAGAGAATCTGTCTGCTTGGG - Intergenic
1187579427 X:20592531-20592553 GAGAGAGAATCTGTGCATGCTGG - Intergenic
1187594952 X:20760681-20760703 GAGAGAGAATCTGTGTACTTGGG - Intergenic
1188078635 X:25808592-25808614 TGCAGAGAATCTGTGCATTTGGG - Intergenic
1188112796 X:26212057-26212079 GAGAGAGAATCTGTGCACTGTGG - Intergenic
1188118657 X:26277803-26277825 CATAGGGAATCTGTGCAGTTAGG - Intergenic
1188363734 X:29288393-29288415 AAGCGAGAATATGTGGAGTTTGG + Intronic
1188364156 X:29294266-29294288 AAGAGTAAAATTGTGCACTTTGG + Intronic
1188716552 X:33465490-33465512 GAGAGAGAATCTGTGTGCTTAGG - Intergenic
1188924510 X:36023301-36023323 GAGAGAGACTCTGTTCATTTGGG - Intergenic
1188980419 X:36721982-36722004 AAGAGAGAATCGCTGCCATTGGG + Intergenic
1188992351 X:36837573-36837595 GAGAGAGAATCTGTACACTTGGG - Intergenic
1189013570 X:37071726-37071748 TACAGAGAATCTGTGCATTTAGG - Intergenic
1189412007 X:40780621-40780643 AAGAAAGAATCTGTGGGCTTGGG - Intergenic
1189628045 X:42920712-42920734 AAGAGAAAATCTGTGTACTGGGG + Intergenic
1189854241 X:45208163-45208185 GAGAGAGAATCTGTGTCCTTGGG - Intergenic
1189854525 X:45210236-45210258 GAGAGAGAATCTGTGTGCTTAGG - Intergenic
1189869911 X:45370884-45370906 GAGAGAGAATCTGTGAAGGTGGG + Intergenic
1189875800 X:45434533-45434555 GAGAAAGAATCTGTGTACTTGGG - Intergenic
1189884953 X:45533099-45533121 AAGAGAGAGCCTGTGCACTTGGG + Intergenic
1190046071 X:47112477-47112499 GAGAGAGAATCTGTGCACTTGGG + Intergenic
1190522896 X:51298410-51298432 GAGAGAGAATCTGTGCATGTGGG + Intergenic
1190588243 X:51968542-51968564 CATGGAGACTCTGTGCACTTGGG - Intergenic
1190602761 X:52109159-52109181 CAGAGAGAATCTCTGTACTTAGG - Intergenic
1190804682 X:53824210-53824232 GAGAGATAATCTGTGTACTTTGG + Intergenic
1190898925 X:54650295-54650317 AAGAGAGAATCTGAGCACTTGGG + Intergenic
1191179052 X:57540091-57540113 GAGAGAGAATCCATGCACTTGGG + Intergenic
1191197053 X:57736002-57736024 AAGAGAGAGTCTGTGCATTTTGG + Intergenic
1192206264 X:69098473-69098495 AAGAGTGACTCTGTCCTCTTGGG + Intergenic
1192793298 X:74405710-74405732 GAGAGAGAATCTGTGCACTTGGG + Intergenic
1192826837 X:74705553-74705575 GAGAAAGAATCTGTGTGCTTGGG - Intergenic
1192841075 X:74856834-74856856 GAGAGAGAATCTCTGTGCTTAGG + Intronic
1192872574 X:75198847-75198869 AAGAGAGAATCTCTGCACTTGGG + Intergenic
1192875352 X:75223670-75223692 GAGAGATAATCTGTGCATTTGGG - Intergenic
1192890811 X:75389027-75389049 GAGACAGACTCTGTGAACTTGGG + Intronic
1193004937 X:76605988-76606010 GAAAGAGAATCTGTGCATTCTGG + Intergenic
1193052510 X:77116092-77116114 GGGAGAGAATCTGTGTACTTGGG - Intergenic
1193191231 X:78573321-78573343 GAGAGAGAATCTGTGCATTTGGG - Intergenic
1193335577 X:80285010-80285032 GAGAGAGAATCTGTCTGCTTGGG + Intergenic
1193366834 X:80644380-80644402 GAGAGAGAATCTATGCACTTGGG - Intergenic
1193580364 X:83257080-83257102 GAGAGTGAATGTGTGCACTTTGG + Intergenic
1193675976 X:84453391-84453413 GAGAAAAAGTCTGTGCACTTAGG + Intronic
1193738357 X:85186659-85186681 GAAAGAAAATCTGTGTACTTAGG - Intergenic
1193742235 X:85231608-85231630 AAGAGAGAACTTGTGTGCTTGGG + Intergenic
1194016144 X:88624280-88624302 CAAAGAGAATCTGTGCACGTGGG + Intergenic
1194095641 X:89635999-89636021 GAGAAAGAATCTGTGCACTTGGG + Intergenic
1194110117 X:89823776-89823798 GAGAGACAATCTGTGCTCTAGGG + Intergenic
1194189278 X:90815298-90815320 AAGAGAAAAGCTATGCACATGGG + Intergenic
1194220032 X:91178259-91178281 GAGAGAGAATCTGTGCACTTTGG - Intergenic
1194288656 X:92040507-92040529 AGGAGAGAATCTTTGCACTTGGG - Intronic
1194291169 X:92073124-92073146 GAGAAAGAATATGTGCATTTTGG - Intronic
1194316197 X:92380029-92380051 AAGAGAAGAGCTGTGCCCTTTGG + Intronic
1194327798 X:92541377-92541399 CACAGAGAGTTTGTGCACTTGGG - Intronic
1194329302 X:92560996-92561018 AAGAGAGACTCTGTTTATTTGGG + Intronic
1194387674 X:93277544-93277566 GAGAGAAAATCTGTGTGCTTGGG + Intergenic
1194398086 X:93411427-93411449 GAGAGAGAATCTGTGTGCTTGGG + Intergenic
1194466544 X:94240760-94240782 GAGTGAGAATCTGTGTGCTTGGG - Intergenic
1194479468 X:94401938-94401960 GAGAAAGAATCTGTGCACTTTGG - Intergenic
1194626222 X:96229495-96229517 GAGAGAGAATCTGTGTGCTTGGG + Intergenic
1194693046 X:97010269-97010291 GAGACAGATTCTATGCACTTTGG - Intronic
1194788601 X:98118190-98118212 GAGAGAGAATCTGTGCACTTGGG + Intergenic
1194882681 X:99273434-99273456 GAGAGAAAAACTGCGCACTTAGG + Intergenic
1194937746 X:99971149-99971171 GAGAGAGATTCTGTGTTCTTGGG - Intergenic
1195081267 X:101373224-101373246 TTAAGAAAATCTGTGCACTTTGG - Intronic
1195115631 X:101695678-101695700 GAGAGAGAATCTGTGCACTTGGG + Intergenic
1195199238 X:102532108-102532130 AAGAGGGAATCTGTGCACTTTGG + Intergenic
1195406642 X:104521880-104521902 AGGATAGAATCAGTGAACTTGGG - Intergenic
1195872250 X:109498642-109498664 GAGAGATAATCTGTGCACTTGGG - Intergenic
1196153114 X:112396261-112396283 TAGAGAGAATCTGTGCATTTGGG - Intergenic
1196264516 X:113626494-113626516 AAGACAGAATCTGTGTACTTAGG - Intergenic
1196368737 X:114951949-114951971 AAGAGAGAATCCATGTGCTTGGG + Intergenic
1196485712 X:116204188-116204210 AAGAGAGAATCTATGCGCTTTGG - Intergenic
1196619476 X:117806308-117806330 GAGAGAGAATCTGCGCACTTGGG + Intergenic
1197030599 X:121809217-121809239 AAGAGAGAATCTGTGTGCTTGGG - Intergenic
1197072819 X:122321330-122321352 GAGAGAGAATTTATGCATTTTGG + Intergenic
1197117646 X:122852023-122852045 GAGAGAGAATCGATACACTTGGG + Intergenic
1197177956 X:123504755-123504777 GAGAAAGAATCTGTGCCCTTGGG + Intergenic
1197375878 X:125681713-125681735 AAGAGAGCATCTGTGTACCTGGG + Intergenic
1197399865 X:125977331-125977353 GAGAGAGAATCTGTGTGCTTGGG + Intergenic
1197457896 X:126700954-126700976 GAGAGAGAATCTCTGCACTTTGG + Intergenic
1197481631 X:126994204-126994226 GAGAGAGAATCTGTGTGCTTTGG + Intergenic
1197487859 X:127075486-127075508 GAGAAAGAATCTGTGTGCTTGGG - Intergenic
1197561815 X:128033734-128033756 GAGAGAGAAGCTCTGCACTTGGG + Intergenic
1197953030 X:131918376-131918398 GAAAGAGAATCTGTGCACTTGGG + Intergenic
1198135535 X:133745988-133746010 AGGAGAGAAACTTTGAACTTAGG - Intronic
1198274129 X:135085550-135085572 GAGAGAGAATCTGTGCACTTGGG - Intergenic
1198430941 X:136565542-136565564 GAGAGAGAATCTGTGCACTTGGG - Intergenic
1198559266 X:137830989-137831011 GAGACAGAATCTGTGCACTTTGG + Intergenic
1198578399 X:138036351-138036373 GAGAGAGTATTTGTGCACTTGGG + Intergenic
1198611873 X:138410945-138410967 GAGAGAGAATCTGTGCATTTAGG + Intergenic
1198663304 X:138995144-138995166 GAGAGAGAATCTGTGCACTTGGG + Intronic
1198761553 X:140038320-140038342 GAAAGAGAATCTGTGTCCTTTGG + Intergenic
1198770690 X:140126928-140126950 GAGAGAGAATCTGTGCACTTGGG - Intergenic
1199005605 X:142693036-142693058 CAGAGAGAATTTGTGCTCTTCGG + Intergenic
1199018671 X:142848933-142848955 AAGAAAGAGTCTGTGCATGTGGG - Intergenic
1199197376 X:145047461-145047483 AAGAGAGAATCTGTGCACTTGGG + Intergenic
1199303835 X:146244374-146244396 AAGAGAGAATCTGTGCATTTGGG + Intergenic
1199306469 X:146272711-146272733 GAGAGAGAATTTGTGTACTTAGG - Intergenic
1199455308 X:148021222-148021244 GAAAGAGAATCTGTGCACTTGGG - Intronic
1200177198 X:154125508-154125530 GAGAGAGAAGCTGTACACTTGGG + Intergenic
1200364368 X:155645648-155645670 GAGAGAGAATCTGTGCATTTGGG - Intronic
1200370097 X:155715892-155715914 GTGAGAGAATCTTTGCACTTTGG - Intergenic
1200379421 X:155819371-155819393 AAGAGAGAATTTGTGTGCTTGGG + Intergenic
1200448640 Y:3297367-3297389 GAGAAAGAATCTGTGCACTTGGG + Intergenic
1200462776 Y:3478517-3478539 GAGAGACAATCTGTGCTCTAGGG + Intergenic
1200535855 Y:4397191-4397213 AAGAGAAAAGCTATGCACATGGG + Intergenic
1200556543 Y:4642020-4642042 GAGAGAGAATCTGTGCACTTTGG - Intergenic
1200606177 Y:5265072-5265094 AGGAGAGAATCTTTGCACTTGGG - Intronic
1200608677 Y:5297699-5297721 GAGAAAGAATATGTGCATTTTGG - Intronic
1200624241 Y:5491602-5491624 AAGAGAAGAGCTGTGCCCTTTGG + Intronic
1200636512 Y:5660595-5660617 CACAGAGAGTTTGTGCACTTGGG - Intronic
1200638001 Y:5680185-5680207 AAGAGAGACTCTGTTTATTTGGG + Intronic
1201470067 Y:14323301-14323323 AAGAGCAAAGCAGTGCACTTTGG - Intergenic
1201979504 Y:19891808-19891830 AAGGGAGAATCTGTACACTTTGG + Intergenic