ID: 1014378648

View in Genome Browser
Species Human (GRCh38)
Location 6:120711133-120711155
Sequence AGAGAGAATCTGTGCACTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 987
Summary {0: 25, 1: 71, 2: 143, 3: 220, 4: 528}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014378645_1014378648 1 Left 1014378645 6:120711109-120711131 CCTTGGCAGTGGCACATGACATG No data
Right 1014378648 6:120711133-120711155 AGAGAGAATCTGTGCACTTGGGG 0: 25
1: 71
2: 143
3: 220
4: 528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014378648 Original CRISPR AGAGAGAATCTGTGCACTTG GGG Intergenic
900144187 1:1150829-1150851 AGAGGGAATCTGGGGACTTGGGG - Intergenic
900202734 1:1418484-1418506 GGACAGAAATTGTGCACTTGGGG - Exonic
901457626 1:9372343-9372365 AGGGAGCATCTGTGAACTTCAGG - Intergenic
902505473 1:16936943-16936965 AGGGAGCATCTGTTCACTAGGGG + Intronic
903292916 1:22326058-22326080 AGGGAGGAGCTGGGCACTTGAGG - Intergenic
903821595 1:26107115-26107137 AGACTAAATCTGTGCACTAGGGG + Intergenic
904183806 1:28686854-28686876 AGCCATAATCTGTGCACTTGGGG + Intronic
905549265 1:38823113-38823135 AGAGAGAGGCTGGGCGCTTGGGG + Intergenic
906897652 1:49794994-49795016 AGACAAAATCTCTGCCCTTGAGG + Intronic
907261519 1:53221920-53221942 AGAGAGAATCTGTGTGCTTATGG + Intergenic
907766564 1:57418220-57418242 TGAGAGAATCTGGGAAATTGAGG - Intronic
908093015 1:60706624-60706646 AGAGAGAATCTGTATGCATGGGG + Intergenic
908093090 1:60707029-60707051 GGAGAGACTCTTTCCACTTGGGG + Intergenic
908363277 1:63390823-63390845 AGAGAGAATCTGTGTGTTTGGGG - Intronic
908397698 1:63741236-63741258 AGAGAGAATCTGTGCACTTGAGG - Intergenic
908588232 1:65597884-65597906 GGAGATAATTTGTGAACTTGAGG + Intronic
909209816 1:72808777-72808799 AGAGAGAAGCTGTGTACTTGGGG - Intergenic
909728661 1:78867517-78867539 AGAGAGACTTTGTTGACTTGGGG - Intergenic
909902972 1:81160894-81160916 ACATAGAATCTGTGCACCTGGGG + Intergenic
910330543 1:86068332-86068354 AGAGAGAATCTGTGCACTCTAGG + Intronic
910384222 1:86664326-86664348 AGAGAGAATCTGTGTGCTTAAGG + Intergenic
910384433 1:86665594-86665616 AGAGAGAATCTGTGTGCTTAAGG - Intergenic
910627401 1:89322721-89322743 AGAGAGAATCTGTGTGCTTGGGG - Intergenic
910716514 1:90236779-90236801 AGAGAGAATCTGTGCACTTTTGG - Intergenic
910724839 1:90327769-90327791 AAAGAGAATCCGTGTGCTTGAGG + Intergenic
910818733 1:91321661-91321683 AGAGAGAATGTGTGTACGTGTGG - Intronic
911011604 1:93287156-93287178 AGGGAGAATCTGTGCTCTTGGGG + Intergenic
911012603 1:93297081-93297103 AGAGAGAATCTGTGCATTTTGGG - Intergenic
911241476 1:95471745-95471767 ACAGACAATCTGTGCACTTGGGG - Intergenic
911276103 1:95861217-95861239 GGAAAGAATCTATGAACTTGAGG - Intergenic
911344104 1:96675150-96675172 AGACAGAATGAGTACACTTGGGG - Intergenic
911519990 1:98917829-98917851 AAAGAGCATCTTTGCATTTGTGG - Intronic
911912709 1:103655182-103655204 GGACAGAAATTGTGCACTTGGGG - Intergenic
911915746 1:103696766-103696788 GGACAGAAATTGTGCACTTGGGG + Intronic
911920121 1:103749320-103749342 GGACAGAAATTGTGCACTTGGGG - Intronic
911942863 1:104069537-104069559 AGATAGAATCTGTGCACTTTGGG - Intergenic
911960840 1:104300891-104300913 AGAGACAATCTGGGCATTTCGGG + Intergenic
912015235 1:105026664-105026686 AGAGAGAATCTGTTTTCTTGGGG + Intergenic
912152638 1:106879419-106879441 AAAGAGAGTCTGTGTACTTGAGG + Intergenic
912316304 1:108670230-108670252 ACAGAGAGTCTATGCACTTGGGG + Intergenic
912616883 1:111110729-111110751 AGAGAGAATCTCTGTGCTTGGGG - Intergenic
912871400 1:113310456-113310478 GGAGAAAATCTGGGTACTTGGGG + Intergenic
913332025 1:117675653-117675675 AGAGACAACCTGAGCACTGGTGG - Intergenic
913428224 1:118758593-118758615 AGAGAGAATATGGGAACTGGAGG - Intergenic
913973719 1:143436952-143436974 AGAGGGAATGTGGGGACTTGGGG + Intergenic
914068105 1:144262559-144262581 AGAGGGAATGTGGGGACTTGGGG + Intergenic
914111050 1:144703795-144703817 AGAGGGAATGTGGGGACTTGGGG - Intergenic
914926111 1:151889538-151889560 AGATAGGATCTTTGCCCTTGTGG + Intronic
915185822 1:154104512-154104534 AGAGAGAATCTGTGCACCTGGGG + Intronic
915186253 1:154107535-154107557 AGAAAGAATCAGTGAGCTTGAGG + Intronic
916309670 1:163382670-163382692 AGAGAGAATGGTTGGACTTGAGG + Intergenic
916341947 1:163745968-163745990 AAAGAGAATCTGTGCCCTTGAGG - Intergenic
917300681 1:173570856-173570878 AGAGAGAATCTGTGCACTTGGGG - Intronic
917376550 1:174353743-174353765 AGACAGAATCCATGTACTTGGGG - Intronic
918018963 1:180665681-180665703 AGAGAGAATCTCTGCACTTGAGG - Intronic
918323490 1:183387647-183387669 AGACAGAAGCTGGGCATTTGGGG - Intronic
918357887 1:183723481-183723503 AAAGAGAATCTGTGCTCTTGCGG + Intronic
918476324 1:184928652-184928674 AGACAGAATCTGTATGCTTGGGG - Intronic
919143874 1:193608709-193608731 GGAAAGAATCTGTGAACTTAAGG - Intergenic
919169699 1:193938528-193938550 AGAGAGAATCTGTGCACTTGGGG + Intergenic
919367405 1:196680482-196680504 AGAGAGAATATGGACAGTTGTGG + Intronic
919441392 1:197637926-197637948 AGAAAGAGTCTCTGCACTTCGGG + Intronic
919455766 1:197818247-197818269 AGAGAGAATCTGTGCTTTGGGGG + Intergenic
919505200 1:198389690-198389712 AGAGAGAGACTGATCACTTGGGG + Intergenic
919515027 1:198511725-198511747 AGAGAGAATTTGTGTGCTTGGGG - Intergenic
920392377 1:205616531-205616553 AGACATAACCTATGCACTTGTGG - Exonic
921393118 1:214637283-214637305 AGACAGAGTCTCTGCCCTTGGGG - Intronic
921658279 1:217767607-217767629 AGGAAGAATCTCTGAACTTGAGG - Intronic
921700021 1:218258647-218258669 AGAGAGATTCTGTATGCTTGGGG + Intergenic
921775077 1:219088662-219088684 GGAGAGGATCTGTGTTCTTGTGG + Intergenic
921929507 1:220743580-220743602 AGAGAGAGTCTGTGCTCTTGGGG - Intergenic
922044185 1:221927855-221927877 TGAGATAATCTGTGCACTTAGGG + Intergenic
922320596 1:224483052-224483074 AGAGAGAATCTGTGTGCTTAAGG - Intronic
922388662 1:225114800-225114822 AGAGAGAATGAGTGTGCTTGGGG - Intronic
923625551 1:235611142-235611164 AGAGAGAATCTCTGCCCTGTGGG - Intronic
924270070 1:242322977-242322999 AGAGAGACTGTCTGCCCTTGTGG - Intronic
924312848 1:242763802-242763824 AGAGAAACACTGTCCACTTGGGG + Intergenic
924516327 1:244769035-244769057 AAAGAGAACCTGTGTGCTTGGGG - Intergenic
1063534427 10:6869524-6869546 AGATAGATTCTGTTCACATGGGG - Intergenic
1063855200 10:10242312-10242334 AGAGAGATACTGTCCACTTGGGG - Intergenic
1064066416 10:12185937-12185959 AGAAAGAATATATGCATTTGCGG - Intronic
1064157705 10:12917098-12917120 AGAGAGATCCTCTCCACTTGGGG - Intronic
1064446461 10:15398324-15398346 ACAGAGAATCTGTGTACTTTGGG + Intergenic
1064701542 10:18026761-18026783 AGAGAGAATCTTTGAGCTTGAGG - Intronic
1065087987 10:22199505-22199527 GGAGAGAATCTCTGAGCTTGAGG - Intergenic
1065170655 10:23023749-23023771 TGATAGAATCAGTGAACTTGAGG + Intronic
1065921712 10:30398935-30398957 AGAGAGAATCTGTGCACTTGGGG + Intergenic
1066143112 10:32527238-32527260 AGAAAGAATCTGTGCACTTTGGG - Intronic
1066649841 10:37643693-37643715 ATGGAAAATCTGTGCACTGGAGG - Intergenic
1066714837 10:38275775-38275797 AGAGAGACTATCTGCCCTTGTGG + Intergenic
1067032731 10:42889240-42889262 ATGGAAAATCTGTGCACTGGAGG - Intergenic
1067258197 10:44663521-44663543 AGATTGAATCTGTGAACTTTGGG - Intergenic
1068453456 10:57223858-57223880 TGACAGAATCTGTTAACTTGTGG + Intergenic
1069193575 10:65520326-65520348 AGACAGAATCTGTGCACTTGAGG - Intergenic
1069343313 10:67438717-67438739 AGAGAGAATCTGTGCACAAGGGG + Intronic
1069574697 10:69518055-69518077 AGACAGAATATGTGTACTTCAGG + Intergenic
1069966331 10:72120323-72120345 AGAAAGAATCTCTGAGCTTGAGG + Intronic
1071084479 10:81852921-81852943 AGAGAGAAGCTGTCTACTTCTGG + Intergenic
1071896842 10:90076848-90076870 TGAGAGAATCTGTGCATTTGGGG - Intergenic
1071962545 10:90821306-90821328 ATAGAGAATCCGTGCACTTGGGG + Intronic
1072058665 10:91787361-91787383 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
1072146094 10:92639823-92639845 AGAGAGATTCTGTGCTTTGGAGG + Exonic
1072231248 10:93415725-93415747 AGATAGGATCTGTGCAAATGCGG - Intronic
1072341981 10:94460826-94460848 AGACAGAATCTCTGAACTTGAGG - Intronic
1072576085 10:96701448-96701470 TGAAACCATCTGTGCACTTGGGG + Intronic
1072842929 10:98795344-98795366 ACGGAAAGTCTGTGCACTTGGGG + Intronic
1072853763 10:98925046-98925068 AGAGAGAACTTGAGCACTTTGGG - Intronic
1073872309 10:107879631-107879653 AGAGAGAATCTGTGCACTTGGGG + Intergenic
1074410495 10:113223980-113224002 AGAGAACATCCTTGCACTTGGGG + Intergenic
1074573558 10:114647352-114647374 AGATAGAGTCTGTGCCCTTTAGG + Intronic
1074951381 10:118340627-118340649 AGAGAAACTCTGTACACTTCAGG + Intronic
1075338899 10:121629873-121629895 AGAGTGGATCTGTGCAGTTTGGG - Intergenic
1076376704 10:129993122-129993144 AGAGAGAATCTGTGCACTTGGGG + Intergenic
1076426983 10:130373865-130373887 AAAGAGTACCTGTGCCCTTGTGG - Intergenic
1077202811 11:1320421-1320443 GGAAAGAATCTCTGAACTTGAGG + Intergenic
1077427325 11:2489218-2489240 AGAGAGAATCTGAGAGCTTGGGG + Intronic
1077432178 11:2521269-2521291 AGAGGGGATCTGTGGACATGGGG - Intronic
1077835367 11:5922641-5922663 AGAGAGAATCTGTTAACTTTGGG + Intronic
1077842353 11:5989291-5989313 AGAGAACAGCTGTGCATTTGTGG + Intergenic
1077858761 11:6156780-6156802 ACAGAGAATCTGTGCACTTGTGG + Intergenic
1077879835 11:6340429-6340451 AGAGAGAAACTTTGCTTTTGAGG - Intergenic
1078070911 11:8109725-8109747 GGAGAGAATCTGTGTGCTTATGG - Exonic
1078244723 11:9563642-9563664 AGAGAGAATCTGTGTGCTTCAGG - Intergenic
1078992519 11:16664363-16664385 AGAAAGAATCTGTACACTTGGGG + Intronic
1079241273 11:18723821-18723843 AGATAGAATCTGTTCACCTATGG + Intronic
1079516901 11:21280503-21280525 AGAGAGAATCTGTGCATTTGTGG + Intronic
1079760149 11:24319172-24319194 AGAGAGAATCTGTGCACTTGAGG - Intergenic
1080351000 11:31385920-31385942 AAAGAGAATCCGTGTGCTTGGGG + Intronic
1080473928 11:32572250-32572272 GGGGAGAATCTTTGCATTTGAGG + Intergenic
1080707257 11:34707965-34707987 AGAAACAATCTGTGCACTTGAGG - Intergenic
1081340341 11:41919962-41919984 AGAAAGAATCTGTGAGCTTCAGG - Intergenic
1081699805 11:45145995-45146017 AGAGAGATTCTGAGAACTGGAGG - Intronic
1082131163 11:48490999-48491021 AGAGATAATCTGTGCACTTGAGG - Intergenic
1082245650 11:49919141-49919163 AGAGATAATCTGTGCACTTGAGG + Intergenic
1082564656 11:54661864-54661886 AGAGATAATCTGTGCACTTGAGG - Intergenic
1083301459 11:61741586-61741608 AGAGTGAATCTGTGCTTTTGTGG - Intronic
1083512891 11:63227959-63227981 ACAGAGAATCTGTGCACTTGGGG - Intronic
1083538978 11:63498488-63498510 GAAGAGAATCTGTGCACTCTGGG - Intergenic
1083575137 11:63785009-63785031 GGAAAGAATCTCTGCGCTTGAGG + Intergenic
1084763964 11:71295425-71295447 AGGGAGAATCTGTGCACTCTGGG - Intergenic
1085147196 11:74212172-74212194 AGAGAGAATCTGTGTGCTTGTGG + Intronic
1085194856 11:74662981-74663003 ACAGAGAATCTGTGTGGTTGGGG - Intronic
1085372408 11:76021046-76021068 ACAGAGCATCTGTGCTCTTGAGG - Intronic
1085562658 11:77486608-77486630 AGAGAGAATCTATGTGTTTGGGG + Intergenic
1085572249 11:77569555-77569577 ACAGAGAGTCTGTGCACTTGTGG - Intronic
1085686912 11:78631741-78631763 GGAGAGAATCTGTGTGCTTAGGG - Intergenic
1085938879 11:81184663-81184685 AGAGAGAATCTGATCATTTTAGG + Intergenic
1086249841 11:84799351-84799373 AGAGAGAATCTGTGCACTTGGGG - Intronic
1087012992 11:93530794-93530816 AGAAGGAATGTGTGCACTTGGGG - Intronic
1087032140 11:93716306-93716328 AGAGAGAATCTGTATGCTTGGGG - Intronic
1087135648 11:94716092-94716114 AGACAGAATCAGTGAACTTAAGG - Intronic
1087691148 11:101321566-101321588 AGAGAGAATCTGTATTCTTGGGG - Intergenic
1087871314 11:103296035-103296057 AGAGAGAATCTGTGTGCGTAGGG - Intronic
1088135925 11:106555137-106555159 ATAGAGAATCTATGCACTTTGGG - Intergenic
1088181703 11:107120733-107120755 TGAGAGAATCTGTGTGCTTGGGG + Intergenic
1088330633 11:108647567-108647589 AGAGAGAACATGTGCTCTTGTGG + Intergenic
1088999641 11:115040957-115040979 AGAGGAAATCTGTGCAACTGAGG + Intergenic
1090111097 11:123910463-123910485 ATGTAGAATCTGTGCACTTTGGG + Intergenic
1090210497 11:124917590-124917612 AGAGAGAATCTCTGCACTTGCGG - Intergenic
1090317599 11:125807803-125807825 ACAGAGACCCTGTGCACTTGGGG + Intergenic
1090426506 11:126610532-126610554 AGAGAGAATGTTTGCATTGGAGG + Intronic
1090841788 11:130496225-130496247 AGAAAGAATCTCTGAGCTTGAGG - Intergenic
1091104494 11:132905964-132905986 TTAGAAAATCTGTGCATTTGAGG - Intronic
1091275968 11:134350449-134350471 AGAGAGGATCTGTGCATTTGGGG - Intronic
1091565830 12:1647168-1647190 AGAGAGAAACCGTACACCTGGGG - Exonic
1091938627 12:4454165-4454187 GGAAAGAATCTCTGAACTTGAGG + Intergenic
1092670753 12:10858295-10858317 ATGGAGAATCTGTAGACTTGGGG + Intronic
1093122899 12:15294582-15294604 AGAGGGAATGTGTGCACTTAGGG + Intronic
1093324912 12:17761262-17761284 AGAGATCGTCTGTGCACTTGGGG - Intergenic
1093531903 12:20175276-20175298 AGAGAAAATCTGTGCAGTTGAGG - Intergenic
1093581737 12:20791218-20791240 AGAGAGAATCTGTGCACTGTGGG - Intergenic
1093694381 12:22143703-22143725 ACAGAGAATCTGTGCACTTGAGG + Intronic
1093903449 12:24662051-24662073 AGACAGAATCTGTGCATTTGAGG - Intergenic
1094231464 12:28108904-28108926 AGAGAGAATTGGTGCAGCTGTGG + Intergenic
1095163209 12:38941064-38941086 AGAGAGAATCTGTACACTTTGGG + Intergenic
1095181828 12:39154829-39154851 AAAGAGAATCTGTGCACTTGGGG - Intergenic
1095860137 12:46907778-46907800 AGAGAGAATCTGTGCACTTGGGG + Intergenic
1096015201 12:48265981-48266003 AGAGAGGATGTGTGCTCTGGTGG - Intergenic
1096233463 12:49910350-49910372 AGAGAGAACCTGTGCTTTTGAGG + Intergenic
1096266146 12:50124106-50124128 AGAGAGAATCTCTGTCTTTGAGG + Intergenic
1096319658 12:50600482-50600504 AGTGAAAATCTGTTCACTGGAGG + Intronic
1096344074 12:50829503-50829525 AGAGAGCATCTGTGTGCTTTGGG - Intergenic
1096727591 12:53577268-53577290 ACAAAGAATCTCTGAACTTGAGG + Intronic
1097498005 12:60366704-60366726 AGAAAGAATCTCTGAGCTTGAGG + Intergenic
1097508510 12:60506909-60506931 AGAGAAAGTCTGTGCACTTGGGG + Intergenic
1097894846 12:64814568-64814590 AGATAGAATCTGTCCTCCTGAGG + Intronic
1097899391 12:64857923-64857945 AGAAAGAGTCTGTGCACTTGGGG - Intronic
1098046591 12:66407516-66407538 AGAGAAAAACTGTGCACTTGTGG + Intronic
1098395197 12:70010189-70010211 AGAGACAATCTGTGCACTTGGGG + Intergenic
1098503839 12:71226540-71226562 AGAAAGAATCTGTGCACTTGGGG + Intronic
1098961375 12:76743339-76743361 AGAGATGCTCCGTGCACTTGAGG - Intergenic
1099101016 12:78440118-78440140 AGAGAGAATCTGTGTGCTTGGGG - Intergenic
1099420939 12:82459715-82459737 GGAAAGAATCTGTGAACTTGAGG + Intronic
1099523209 12:83689399-83689421 AGAGAGAATCTTTGTGCTTGAGG + Intergenic
1099562339 12:84193597-84193619 GGAGAAAATCTGTGCACTTTGGG - Intergenic
1099576315 12:84388373-84388395 AGAAAGAATCTCTGAATTTGAGG - Intergenic
1099764271 12:86961651-86961673 AAAGAGAGCCTGTGCACTTGAGG - Intergenic
1099807829 12:87542788-87542810 GGAGGGAATCAGTGCACTTGGGG + Intergenic
1099826232 12:87780575-87780597 AAAGAGAATCTGTGCATTTTGGG - Intergenic
1099882079 12:88479529-88479551 AGAGAGAATCTAAGCGCTTGGGG + Intergenic
1099933236 12:89097819-89097841 AGACAAAATCTCTGCCCTTGTGG + Intergenic
1100381109 12:94062773-94062795 AGAGAAAATATGTGTGCTTGGGG + Intergenic
1100904804 12:99285732-99285754 AGAGAGAATCTGTGTGCTTGGGG + Intronic
1100946297 12:99787795-99787817 ATAGAAAATCTGTGCATTTTAGG + Intronic
1100996734 12:100308920-100308942 AGACATAATCTGTGCACTTGGGG - Intronic
1101539138 12:105648811-105648833 TGAGAGAATAAGTGCACTTTGGG + Intergenic
1101607367 12:106257869-106257891 AGAGAGAATCTGTGCACTTGAGG + Intronic
1102266511 12:111490786-111490808 AGAAAGAATCTGTGTGCTCGGGG + Intronic
1103031475 12:117617292-117617314 AGAGAGAATTAGTGAACTAGCGG - Intronic
1103416062 12:120742006-120742028 AGAGCCAGTCTGTGCACTCGGGG + Intergenic
1104097561 12:125571678-125571700 AGAGAGAATATGCACATTTGGGG - Intronic
1106792798 13:33172800-33172822 AGAAAGAATCTGTTCTATTGTGG + Intronic
1106864576 13:33949233-33949255 AGAGAGAATGAGTGCAAGTGGGG - Intronic
1107370286 13:39737984-39738006 AGAGAGAATTTATGTGCTTGTGG - Intronic
1107774542 13:43823768-43823790 AGAGAGAATCTGTGCACTTGAGG - Intergenic
1108822865 13:54375066-54375088 AGATAGAATATGTAAACTTGAGG + Intergenic
1108997135 13:56748248-56748270 AGAAATAATCTATGCACTTGGGG - Intergenic
1109045784 13:57409266-57409288 AGAGAGAGTCAGTGTGCTTGGGG + Intergenic
1109211369 13:59538986-59539008 AGAGAGAGTCTATGCACTTGGGG - Intergenic
1109336784 13:61004297-61004319 AGACAGAATCTGTGTGCTTGGGG - Intergenic
1109352051 13:61195394-61195416 GGAGAGAACCTGTGCACTTGGGG + Intergenic
1109597366 13:64573839-64573861 AGAAAGAATCTCTGAACTTGAGG - Intergenic
1109747529 13:66646874-66646896 AGACAGTATCTGTACACTTGAGG + Intronic
1109793015 13:67274288-67274310 TGAGAGAAGCTGAGCACTAGAGG - Intergenic
1109854602 13:68110773-68110795 AGAGAGAATCTATGCATTTGGGG + Intergenic
1109961765 13:69640048-69640070 AGAGAGAATCTGTGCATCTGAGG - Intergenic
1110654448 13:77980496-77980518 ATAGAGAATCCGTGGACATGAGG + Intergenic
1110665879 13:78116794-78116816 AGAGAGAATGTGTGCACTTGAGG - Intergenic
1110901396 13:80830332-80830354 AGACAGAATCTTTGTGCTTGGGG + Intergenic
1110916858 13:81031329-81031351 ACAGAAATTCTGTGCACCTGTGG - Intergenic
1111583455 13:90253766-90253788 AGAGAGAACCTGTGTGCTTGGGG - Intergenic
1111639188 13:90946601-90946623 GGAGGGAATCTGTGTGCTTGGGG + Intergenic
1112053924 13:95672042-95672064 AGAGAGAATTTGTACATTTGTGG - Intergenic
1112743209 13:102497773-102497795 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
1112940314 13:104854120-104854142 AGAGAGAATTTGTGCACTTGGGG + Intergenic
1112944506 13:104910772-104910794 AGAGAGAATCTGTGCACTTGGGG - Intergenic
1113244432 13:108378277-108378299 AGAGAGAATCTATGTAGTCGGGG - Intergenic
1113253823 13:108485621-108485643 ATGGGGAATCTGTGCACTTAGGG + Intergenic
1113876802 13:113599761-113599783 AGAGAGAATCCTTGCACTTAGGG + Intronic
1113876851 13:113600061-113600083 AGAGAGAATCCTTGCACGTAGGG + Intronic
1113876870 13:113600173-113600195 AGAGAGAATCCTTGCACGTAGGG + Intronic
1113876910 13:113600393-113600415 AGCGAGAATCCTTGCACTTAGGG + Intronic
1113876947 13:113600602-113600624 AGAGAGAATCCTCGCACGTGGGG + Intronic
1113876977 13:113600784-113600806 AGAGAGAATCCTTGCACGTAGGG + Intronic
1113876995 13:113600903-113600925 AGAGAGAATCCTCGCACGTGGGG + Intronic
1114378525 14:22175383-22175405 GGACAGAAATTGTGCACTTGGGG + Intergenic
1114783851 14:25570977-25570999 ACAGAGAATCTGTGCACTTTGGG - Intergenic
1114994291 14:28328491-28328513 AAAGATAATCTGTGTGCTTGAGG - Intergenic
1115282506 14:31679118-31679140 ACAGAGAATCTGTGTGCTTGGGG - Intronic
1115660882 14:35493583-35493605 AGAGAGAATTTGTGTACTTGGGG + Intergenic
1115930081 14:38481815-38481837 AGAGAGAATCTGTATGCTCGGGG + Intergenic
1116021751 14:39469650-39469672 ACAGAGAATCTGTGCACTCAAGG - Intergenic
1116045604 14:39739675-39739697 AGAAAGAATCTGTGTGCTTTGGG + Intergenic
1116114872 14:40635365-40635387 AGAAAGAACCTGTGCATTTTGGG + Intergenic
1116257007 14:42570149-42570171 AGACAGAATCTGTGTGCTTGGGG + Intergenic
1116354696 14:43913985-43914007 GGAGAGAATCTTTGTGCTTGAGG + Intergenic
1116392724 14:44413019-44413041 AGAGATAAACTGTGCACTTAGGG + Intergenic
1116964393 14:50999502-50999524 AGAGAGAACCTTTGTCCTTGAGG + Intronic
1117237007 14:53788673-53788695 AGAGAGAATGTGTGCCATGGTGG + Intergenic
1117384373 14:55195833-55195855 AGAGAGAATCTGTGCACTTTGGG - Intergenic
1117504550 14:56389132-56389154 AGAGAAAATCTGTGCACTTGGGG - Intergenic
1117607111 14:57440983-57441005 ATAGAGAATCTGTGCACTTAGGG - Intergenic
1117870651 14:60197428-60197450 AGAGAGAATCTGTGCATTTGGGG + Intergenic
1118034287 14:61849647-61849669 GTAAAGAATCTGTGCACTTGAGG - Intergenic
1118241284 14:64060953-64060975 AGAAAGAATCCGTGCACGTGGGG - Intronic
1118991719 14:70802770-70802792 AGACAGAATCTCTGCCCTTGTGG - Intronic
1119111209 14:71975951-71975973 AGAGAGAATTAGTGAACTGGAGG - Intronic
1119723698 14:76908942-76908964 AGAGAGAAGCTGTGGTCCTGTGG + Intergenic
1120100001 14:80434450-80434472 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
1120107861 14:80516768-80516790 AGAGAGAATCTGTGTGTTTTGGG - Intronic
1120275592 14:82369579-82369601 AGAGAGAATCTGTGCACTTGTGG + Intergenic
1120467845 14:84884516-84884538 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
1120638889 14:86985558-86985580 AGAGAGAAGCTGAGAACTTTTGG - Intergenic
1120975962 14:90248492-90248514 AGAGAGAATCATTCCATTTGGGG + Intergenic
1121349955 14:93165465-93165487 GGACAGAAATTGTGCACTTGGGG + Intergenic
1122482543 14:102056357-102056379 GGACAGAAATTGTGCACTTGGGG + Intergenic
1123961213 15:25402684-25402706 AGAGAGAGACTGTTCACCTGGGG - Intronic
1125005168 15:34808655-34808677 GGATAGAATCAGTGAACTTGAGG + Intergenic
1125277119 15:38004713-38004735 AGAGAGAATCTGTGCACTTTGGG - Intergenic
1125567589 15:40688977-40688999 AGAGAGAATGGGTGCTCCTGGGG + Intergenic
1125878336 15:43169038-43169060 AGAGATAATCTGTGCACTTGTGG - Intronic
1126026176 15:44448181-44448203 TGGGAGCAGCTGTGCACTTGAGG + Intronic
1126306109 15:47259941-47259963 GGAGAGAATCAATGAACTTGAGG - Intronic
1126611374 15:50532950-50532972 AGAAAGAATCTCTGAGCTTGAGG + Intronic
1126660834 15:51031494-51031516 AGAGAGAATATGTGTGCTTTGGG - Intergenic
1126979950 15:54229180-54229202 AAAGAGAATCTGAGTGCTTGAGG - Intronic
1127132522 15:55882340-55882362 ATGGAGAATCCGTGCACTTAGGG + Intronic
1127140264 15:55969105-55969127 AGAGAGAATCTATGCCTTTGCGG + Intronic
1127971652 15:63966757-63966779 AGAAAGAACCTGTGCACTTGGGG - Intronic
1127985843 15:64069791-64069813 AGAGAGAGTCTTTGCTTTTGAGG - Intronic
1128966132 15:72060508-72060530 AGACAGAATCTGTGTACCTGTGG + Intronic
1129030757 15:72616041-72616063 GCTGAGAATCTGTGCACCTGGGG - Intergenic
1129477600 15:75796565-75796587 GCTGAGAATCTGTGCACCTGGGG - Intergenic
1129642262 15:77392940-77392962 AGAGGGAAGCTGTGCACTTGCGG + Intronic
1129835667 15:78703842-78703864 GCTGAGAATCTGTGCACCTGGGG - Intronic
1130400473 15:83547398-83547420 AGAGAGAATCTGTGCACTTGCGG - Intronic
1130441266 15:83956241-83956263 AGAGAGAATCTGTGCACTTCAGG - Intronic
1131323649 15:91421615-91421637 AGAGAGAATTTGTGCACTCCAGG - Intergenic
1131437441 15:92434653-92434675 AGAGGGAATCTGGGCAGTGGAGG + Intronic
1132248957 15:100319038-100319060 AGAGATGACATGTGCACTTGTGG + Intronic
1133087714 16:3377975-3377997 AGAGGAAATCTGTAGACTTGGGG + Intronic
1134464573 16:14463695-14463717 AGAGAGCATCTGTGACCTAGAGG + Intronic
1134802560 16:17099011-17099033 GGAGAAAATTTGGGCACTTGAGG + Intergenic
1137362762 16:47834694-47834716 AGAAAGAATCAGTGAACTTGAGG + Intergenic
1138228275 16:55317897-55317919 AGACAAAATCTTTGCACCTGTGG - Intergenic
1139031425 16:62886194-62886216 AGAGAGAGGCTGTGCATTTGTGG + Intergenic
1140055072 16:71518779-71518801 AGAGACAATCATTGTACTTGAGG + Intronic
1141290407 16:82713400-82713422 AGAGAGCTTCTGTGTCCTTGAGG + Intronic
1141590691 16:85066802-85066824 AAAGAGAATCTCTGCTCTTCCGG - Intronic
1142632288 17:1232801-1232823 AGACACAATCTCTGCACTTGAGG - Intergenic
1143149445 17:4798488-4798510 ACAGAGAATCTTTGTACTTTGGG + Exonic
1144524931 17:15981297-15981319 AGGGAGAGTCTGTACACTGGAGG - Intronic
1145069079 17:19787886-19787908 GGAAATAATCTGTGTACTTGGGG + Intronic
1146728658 17:35175554-35175576 AGAGAGAATGAGTGAATTTGGGG + Intronic
1149231175 17:54536376-54536398 AAACAGAATTTGTGCACTTAGGG + Intergenic
1150541388 17:66103800-66103822 AGAGAGAATCTGTGTATTTGGGG + Intronic
1150550241 17:66203426-66203448 AGGGAGAATCTGTGTGCTTGGGG + Intergenic
1150601667 17:66656243-66656265 ATAAAGAATCTGGGGACTTGGGG - Intronic
1155414959 18:25587989-25588011 GGAAAGAATCAGTGAACTTGAGG - Intergenic
1155726142 18:29085942-29085964 AGTGAAAATCTGTGCAGCTGGGG - Intergenic
1155767344 18:29652345-29652367 ATGGAGAATCTGTGCATTTGGGG + Intergenic
1156021675 18:32606544-32606566 AGAGAGAATCTATGTGCTTGGGG - Intergenic
1156258432 18:35422206-35422228 AGATAGAATCTGTCACCTTGAGG + Intergenic
1156565850 18:38189074-38189096 TGGGAGAATCTATGCACTAGAGG - Intergenic
1156912493 18:42426876-42426898 GCAGAGAATCTGTTCACTTGGGG - Intergenic
1158025104 18:52886488-52886510 AGAGAGAGTCTGTGCAATTGTGG - Intronic
1158481419 18:57824719-57824741 AGAGAGAAACTGTGTGCTTGTGG - Intergenic
1158591345 18:58781422-58781444 GGAAAGAAGCTGTGGACTTGAGG - Intergenic
1158949174 18:62475841-62475863 AGAGAGAATCTGCACATTTTGGG - Intergenic
1159080510 18:63730734-63730756 AGAAAGAGTCTATGCCCTTGAGG + Intergenic
1159329857 18:66978053-66978075 AGAGAGAATCTCTTCTGTTGAGG - Intergenic
1159490664 18:69129540-69129562 AGAGAGAATCTGTGCACTCAGGG - Intergenic
1159802685 18:72920419-72920441 AGAGAGAATGTGTACACTTATGG - Intergenic
1163879766 19:19908422-19908444 TGAGAGTAGCTGTGCACTTTGGG + Intronic
1163918787 19:20268215-20268237 TGAGAGTAGCTGTGCACTTTGGG - Intergenic
1163924275 19:20324147-20324169 TGAGAGTAGCTGTGCACTTTGGG + Intergenic
1163933051 19:20416895-20416917 AGAGAGTAGCTGTGCACTTTGGG - Intergenic
1163935923 19:20443332-20443354 TGAGAGTAGCTGTGCACTTTGGG + Intergenic
1164140501 19:22457475-22457497 TGAGAGTACCTGTGCACTTTGGG + Intronic
1164476145 19:28577472-28577494 AGAGGGCAGCTGTGCACATGTGG + Intergenic
1165583821 19:36894700-36894722 AGAAAGAATTTCTGAACTTGAGG + Intronic
1166185632 19:41137139-41137161 AGAGGGAGGCTGTGCACTTCCGG - Intergenic
1166514116 19:43433021-43433043 AGAGGGAATGTGAGCACCTGGGG - Intergenic
1166757719 19:45203794-45203816 AGAGAGAATCTGTGCATTTGGGG - Intronic
1167832196 19:52033474-52033496 AGAGAGAGTCTGTGGATTGGGGG - Exonic
1168220782 19:54958812-54958834 GGACAGAAACTGTGCACTCGAGG - Intronic
925484842 2:4316550-4316572 AGAGAGAATCTGTACACTTGGGG - Intergenic
925506441 2:4569914-4569936 AGAGAGAATCTGAGAACTAGGGG - Intergenic
925588467 2:5486918-5486940 AGAGAGAATCTGTAAGCTTGGGG + Intergenic
925757268 2:7145676-7145698 AGAGTGAACATGTGCATTTGTGG + Intergenic
926473647 2:13293847-13293869 AGAGAGAATCTGTGTGCTTTGGG - Intergenic
926518746 2:13883389-13883411 AGAGAGAATCTGTGCACAGTGGG + Intergenic
927570410 2:24154028-24154050 AGAGAGAGTTTGTACATTTGGGG - Intronic
927823135 2:26286835-26286857 AGAGAAAATCTGTTCACATCGGG - Intronic
928293439 2:30060582-30060604 ATGGAGAATCTGTGTGCTTGGGG + Intergenic
928295975 2:30084468-30084490 AGGCAGGATCTGTGCACTTGGGG + Intergenic
928483951 2:31710968-31710990 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
928495746 2:31829747-31829769 ACAGAGAATCTGTGCATTTTGGG - Intergenic
928715654 2:34056720-34056742 AGACAGAATCTGTGCCCTTGGGG - Intergenic
928768574 2:34677534-34677556 GGACAGAAATTGTGCACTTGGGG + Intergenic
928834854 2:35531088-35531110 ACAGAGAATCTGTGTGTTTGGGG - Intergenic
928846269 2:35676879-35676901 AGGGGGAATCTGTGCACTTGGGG - Intergenic
928961690 2:36932828-36932850 AGTGAGAATTTGGGCAGTTGAGG - Intronic
929281841 2:40088227-40088249 GAAGAGAATCTATGCACTTGCGG - Intergenic
930190861 2:48458050-48458072 ATAGAGAATCTGTGTACCTTAGG + Intronic
930230820 2:48842065-48842087 AGAAAGAATCTGCACACTTTGGG - Intergenic
930439790 2:51391243-51391265 AGACAGAATCTGGGCACTTGGGG - Intergenic
930521200 2:52469871-52469893 AGAGAGAATGAGTGCAAATGGGG - Intergenic
930878409 2:56245374-56245396 GGAGGGAATCTGTGGGCTTGTGG - Intronic
931095356 2:58934211-58934233 AGACAAAATGTGTACACTTGGGG - Intergenic
931736396 2:65198712-65198734 AGGGAGACTCTGTGCCCTTGGGG + Intergenic
932101140 2:68900358-68900380 AGAGAGAATCTGTATGTTTGGGG + Intergenic
932389413 2:71372474-71372496 GGACAGAGTCTGTGCACTTTAGG - Intronic
932921280 2:75917461-75917483 ACAGAGAAACTGCGCATTTGGGG - Intergenic
933341744 2:81034445-81034467 GGAGAGAATCTTTGTACTTGGGG - Intergenic
933382940 2:81572994-81573016 AGAGAGAACCTGTGAAATTTGGG - Intergenic
934122876 2:88857159-88857181 AAAGTGAATCTTTGCACCTGTGG - Intergenic
934178415 2:89597918-89597940 AGAGGGAATGTGGGGACTTGGGG + Intergenic
934288708 2:91672210-91672232 AGAGGGAATGTGGGGACTTGGGG + Intergenic
934537186 2:95144552-95144574 AGACAGAAGCTTTGCATTTGGGG + Intronic
934637629 2:96005237-96005259 AGAGAGAATCTCTAAGCTTGAGG - Intergenic
934796027 2:97100175-97100197 AGAAAGAATCTCTACGCTTGAGG + Intergenic
934928857 2:98404021-98404043 AGAGAGAATCTGTGTGCTTGTGG + Intergenic
935090782 2:99892952-99892974 AGAGGGAAGGTGTGGACTTGGGG + Intronic
935750835 2:106232544-106232566 AGAGAGAATCTGTGCACATTGGG + Intergenic
935812816 2:106816886-106816908 GAGGAGAATCTGTGCACTTGTGG + Intronic
935835677 2:107050654-107050676 AGAGAAAATCTCTGCACTTGGGG - Intergenic
935874026 2:107486805-107486827 TGATAGAATCTGTGAATTTGAGG - Intergenic
935989252 2:108704759-108704781 AGAGAGAATCTGTGTGATTTGGG + Intergenic
936641547 2:114317379-114317401 AAAGACAATCTGTGCCCTTTGGG - Intergenic
936901463 2:117485814-117485836 AGAGAGAATCTATGTGCTTGTGG - Intergenic
937137781 2:119569738-119569760 GGAGAGAATCTCTGAGCTTGAGG - Intronic
937460943 2:122085281-122085303 AGAGAAAATCTTAGCAATTGAGG - Intergenic
937561893 2:123235793-123235815 AGATAGAATCCGCGAACTTGAGG - Intergenic
937628238 2:124068262-124068284 AGAGAGAATCTGTATACCTCAGG + Intronic
937739360 2:125332601-125332623 GGAGAGAATCTGTGCTCTTGAGG + Intergenic
937859425 2:126696396-126696418 GGAGAAAATCTGGGCACATGGGG + Exonic
938389972 2:130897349-130897371 AGAGAGAATCCATGCAACTGTGG + Intronic
938670369 2:133580729-133580751 AGAGAACATTTGTGCATTTGTGG + Intergenic
939253002 2:139707256-139707278 AGACATAATCTGTGCACTCAAGG - Intergenic
939895462 2:147785791-147785813 AGAGACATTCTGTGCTTTTGAGG - Intergenic
940067968 2:149651063-149651085 AGAGAAAACCTGTGCTTTTGTGG + Intergenic
940629468 2:156219635-156219657 ATGCAGAGTCTGTGCACTTGGGG + Intergenic
940795248 2:158070843-158070865 AGAGGGAATCTGAGCACTTTAGG + Intronic
941047647 2:160694763-160694785 AGAGAGAGTCTGTGCATGTCGGG - Intergenic
941141094 2:161782747-161782769 AGAAAGAATCAGTGAACTTAAGG + Intronic
941746100 2:169088319-169088341 AGGCAGAATCTGCGTACTTGGGG - Intronic
941851931 2:170191656-170191678 GGAGATAATCTGTGCACTTGCGG - Intronic
942391898 2:175503386-175503408 AGAGAGAAACTGTGCACTTTGGG - Intergenic
942778604 2:179614041-179614063 AAAGAGAATCTGTGCATTTGCGG - Intronic
942846042 2:180426761-180426783 AGAAAGAATTAGTGAACTTGAGG + Intergenic
942972383 2:181971892-181971914 AAAGAGAATCTGTGCACTTGAGG - Intronic
942975870 2:182016197-182016219 AGAGAGAATCTGTGTGCTTGTGG - Intronic
943067738 2:183106277-183106299 AGAGAGAATGTGTGTGCTTGGGG - Intergenic
943099661 2:183472247-183472269 AGAGAGAATCTTTAGGCTTGGGG - Intergenic
943427997 2:187759975-187759997 AGAGAGAGTCTGTGTGATTGGGG - Intergenic
943844978 2:192634447-192634469 AGAGAGAATTTGTGTACTGGAGG + Intergenic
943985513 2:194612797-194612819 AGAAAGAATCAGTGAACTTGTGG - Intergenic
944096057 2:195968955-195968977 AGAGAGAATCTGTACACGTCGGG - Intronic
944102703 2:196045545-196045567 AGAGAGAATATGGGTACTTAAGG + Intronic
944133384 2:196370852-196370874 AGAGAGAATCTGTGCGCTTAGGG - Intronic
944287342 2:197966570-197966592 AGAGAGAATCTATGTGCCTGGGG - Intronic
944550154 2:200838307-200838329 AGAGATAATCTGTGAACTTGGGG + Intergenic
944954935 2:204798219-204798241 GGAGAGAATCTGTATGCTTGAGG + Intronic
944990651 2:205230962-205230984 AGACAGAATCTGTGCACCTTGGG - Intronic
945309424 2:208294155-208294177 GGAAAGAATCTTTGAACTTGAGG - Intronic
945334319 2:208573467-208573489 AGAGAGAATCTGTGTGCTTGGGG + Intronic
945754574 2:213830312-213830334 ATAGAGAATCTGTGTGCTTTAGG - Intronic
945803851 2:214465955-214465977 AGAAAGAATCTGTGTGCTTGGGG - Intronic
946509203 2:220335769-220335791 AGAGATAATCTGTGCACTTGCGG - Intergenic
947131035 2:226924831-226924853 ACAGAGAATCTGTGTACTTGGGG - Intronic
947690795 2:232134097-232134119 GCAGAGAATCAGTGAACTTGAGG + Intronic
947927851 2:233937351-233937373 AGGGAGAATGTGTGCAAGTGTGG + Exonic
1168900048 20:1355563-1355585 AGAGAGAATATGTGCACTTCTGG - Intronic
1169320279 20:4626751-4626773 GAATAGAATCTGTGAACTTGAGG + Intergenic
1169377484 20:5077837-5077859 AAAAAAAATCTGTGCCCTTGTGG + Intronic
1169623818 20:7540176-7540198 AGAGAGAATCTGTGTGCCTGGGG + Intergenic
1170062647 20:12275830-12275852 AGAGAAAATCTGTGTGTTTGGGG + Intergenic
1170570065 20:17627548-17627570 AGAGAGAATCCGTTCCATTGAGG - Exonic
1170668259 20:18405862-18405884 AAAGAGAATGTGTGCACTTTGGG + Intronic
1172953066 20:38734433-38734455 AGAGAATATCTCTGCCCTTGTGG - Intergenic
1174537348 20:51261564-51261586 GGACAGAAATTGTGCACTTGAGG - Intergenic
1174690928 20:52503789-52503811 AGAGAGCATCTGTGCACTTGGGG + Intergenic
1174695412 20:52551851-52551873 AGAGAGAATGTGTGTGCTGGAGG - Intergenic
1174766333 20:53257323-53257345 AGAGGCAATGTGTGCCCTTGAGG + Intronic
1174982258 20:55409042-55409064 AGATAGAACCTGTGTGCTTGGGG - Intergenic
1175434126 20:58930532-58930554 AGGGAGAATGTGTTGACTTGAGG + Intergenic
1176175270 20:63719508-63719530 AGAAAGAAACAGTGAACTTGAGG - Intronic
1176914444 21:14608285-14608307 AGAGAGAATATTTGTGCTTGGGG + Intronic
1176940065 21:14912661-14912683 AGAGAGAATCTGTGCACGTTGGG - Intergenic
1176994854 21:15543635-15543657 AGAGAGAATCTGTGCACTTATGG + Intergenic
1177137208 21:17318225-17318247 AGAAAGAATTTGTGCACTTGGGG + Intergenic
1177212761 21:18091018-18091040 AGAGAGACTCTGCTCACTTTGGG + Intronic
1177222336 21:18210315-18210337 AGAGAGAATCTGTGCACATCGGG - Intronic
1177276091 21:18914220-18914242 AAAGAGAATCTGAGCACTTAGGG - Intergenic
1177375977 21:20271240-20271262 GGACAGAAATTGTGCACTTGGGG + Intergenic
1177492867 21:21850141-21850163 AGTGAGAATTTGTACACTTAAGG - Intergenic
1177494702 21:21873532-21873554 AAAGAGAATCTGTGTGCTTGGGG - Intergenic
1177539731 21:22477085-22477107 AGAGAGAATCTGTGTGTTTTGGG + Intergenic
1177760649 21:25399322-25399344 AGGGAGAATCTGTGTGCCTGGGG + Intergenic
1177771188 21:25518541-25518563 AGAAAGAATCTGTGTGCTTGGGG + Intergenic
1178684688 21:34701981-34702003 AGTGAGAATTTGTGAACTTCTGG + Intronic
1181824223 22:25501028-25501050 GGAAAGAATCTGTGAACTGGAGG - Intergenic
1182880635 22:33730083-33730105 AGAGAAAATCTGTGTATTTGTGG - Intronic
1183886349 22:40886349-40886371 AGAGTGAAGCTGTGCATGTGAGG - Exonic
949623101 3:5838039-5838061 AGAGAGAATCTGTGTGCTTGGGG - Intergenic
949895922 3:8767658-8767680 AGAGAGAAGATGTGCACCTGCGG + Exonic
950801202 3:15552998-15553020 GGAGAGAATCTGTGCATTTAGGG - Intergenic
951029404 3:17864148-17864170 ATAGAGAATCTTTGTACTTGTGG - Intronic
951255045 3:20439026-20439048 AGAGAGAATCTGTTCATTTGGGG + Intergenic
951260023 3:20496244-20496266 AAATAGAATCTGTGTACTTTGGG - Intergenic
951393079 3:22130635-22130657 AGAGAGAATCTGTGCTCTTGGGG - Intronic
951398610 3:22202725-22202747 ACAGAGAATCTGTGAGCTTGGGG + Intronic
951398854 3:22204768-22204790 AGAGAGAATTAGTGAGCTTGAGG + Intronic
951437100 3:22677212-22677234 AGAGAGAATCTGTGTGCTTGGGG - Intergenic
951492577 3:23288886-23288908 AGAGAGAATATGTATTCTTGGGG - Intronic
951495170 3:23317412-23317434 AGAGACAATCTGTGCACTTGGGG - Intronic
952566734 3:34668384-34668406 ATGGAGAATCTGTGTATTTGAGG + Intergenic
952672921 3:35993134-35993156 TCTGAGAATCTGTTCACTTGAGG + Intergenic
952991101 3:38831675-38831697 AGAGAGGAGCTGTGCTCTTAAGG - Intergenic
953007730 3:38993798-38993820 AGAGAGACACTAGGCACTTGAGG - Intergenic
953038416 3:39233621-39233643 AGAGGGAATCTGGGTACTTTAGG - Intergenic
953362517 3:42310303-42310325 AGAGAGAACCTGTGCCCTTTGGG - Intergenic
953848315 3:46446121-46446143 AGTGAGATCCTGGGCACTTGGGG + Intronic
954491483 3:50910733-50910755 AGAGACAATCTGTGTACTTGGGG - Intronic
954724629 3:52597125-52597147 ACAGAGAATCTTTGTGCTTGCGG - Intronic
954779909 3:53051317-53051339 AGAGAGAACCTGTTCAGATGGGG - Intronic
954996822 3:54889411-54889433 AGAGAGAAGAGGTCCACTTGTGG + Intronic
955234060 3:57124085-57124107 GCTGAGAAGCTGTGCACTTGAGG - Intronic
955274496 3:57534189-57534211 AGAGAGAATCTGTGCACTTGGGG - Intronic
955585336 3:60471536-60471558 AGAAAGAATCTTTGTGCTTGGGG - Intronic
955681739 3:61508550-61508572 AGATAGAATCAGTGAACTTGAGG - Intergenic
956222764 3:66922261-66922283 AGAGAGAATCAGTGCACTTTGGG + Intergenic
956476662 3:69628505-69628527 AAAAAGAATAAGTGCACTTGAGG + Intergenic
956549380 3:70441337-70441359 AGAGAGAATCTGTACATGTAGGG + Intergenic
956796486 3:72722920-72722942 ACACAGAATTTCTGCACTTGGGG + Intergenic
957369384 3:79272587-79272609 AGAGAGAATTTGTGTGTTTGTGG + Intronic
957448588 3:80346579-80346601 AGAGAGAATTTGTGTGCATGGGG - Intergenic
957672598 3:83324557-83324579 ACAGAGAATATGTGTGCTTGGGG - Intergenic
957810587 3:85215896-85215918 GGAGAGAACCTGTGTGCTTGTGG - Intronic
957977084 3:87460554-87460576 AGAGAGAATCTGTGTGCTTAGGG + Intergenic
958083307 3:88774504-88774526 AAAGAGAAATTGTGTACTTGTGG + Intergenic
958765991 3:98368359-98368381 AGAGACAATCTGTGTGCTTGGGG - Intergenic
958839399 3:99185902-99185924 AGAAAGAATCTGTGTGCTTGAGG + Intergenic
959126063 3:102291349-102291371 AGAGAGAATCTGTGCACTTAGGG - Intronic
959127408 3:102307185-102307207 AGAGACAATCTGTGTGCTTCGGG + Intronic
959294860 3:104522363-104522385 GGACAGAAATTGTGCACTTGGGG + Intergenic
959409156 3:105998423-105998445 AGACAGAATCTGTGTCCTTGGGG - Intergenic
959448402 3:106468088-106468110 ATGGAGAATCTGCGAACTTGGGG - Intergenic
959474237 3:106790152-106790174 GCAGAGAATCTGTGCAATTGGGG + Intergenic
959752080 3:109849886-109849908 AGAGAGACACTGTCCACTTGGGG + Intergenic
959753584 3:109868770-109868792 ATAGATTATCTGTGTACTTGTGG - Intergenic
959868580 3:111300376-111300398 AGATAGAATTTGTGCACTTAGGG - Intronic
959970776 3:112407215-112407237 AGACAGAAATTGTGCATTTGGGG - Intergenic
960067198 3:113386859-113386881 AGAGATAATCTGGGTACTTGGGG + Intronic
960095545 3:113686316-113686338 AGAGAGAATCGCTGTGCTTGGGG - Intronic
960141976 3:114159682-114159704 AGAGACAGATTGTGCACTTGAGG - Intronic
960354010 3:116628863-116628885 GGAGAGTATCTTTCCACTTGAGG - Intronic
960354057 3:116629268-116629290 AGAGAGAATCTGTATGCTTGGGG - Intronic
960404025 3:117238038-117238060 AGAAAGAATCTGTGTGCTTGGGG + Intergenic
960471952 3:118076399-118076421 AGAGAGAATCTGTGTGCTTAGGG - Intergenic
960801980 3:121549018-121549040 GGACAGAAACTGTGCATTTGGGG + Intergenic
960840929 3:121957894-121957916 AGAGAGGAAATCTGCACTTGGGG + Intergenic
960869897 3:122238227-122238249 AGAGAAAATCTGTGCATTTTGGG + Intronic
961260412 3:125597085-125597107 GGACAGAAATTGTGCACTTGGGG + Intergenic
961964549 3:130888659-130888681 ACAGAGAGTATATGCACTTGGGG - Intronic
962038901 3:131683978-131684000 ATACAGAATCTGTGTGCTTGGGG - Intronic
962078829 3:132115217-132115239 AAAGAGAATCTGTGTGTTTGGGG - Intronic
962767470 3:138579053-138579075 AGAGAGAATCTGTGCACTTAGGG + Intronic
962997971 3:140650696-140650718 AGAGAGAATGTATGTGCTTGGGG + Intergenic
963020598 3:140869484-140869506 AGAGATAATCTATGTGCTTGGGG - Intergenic
963154017 3:142077019-142077041 AGAGAGAATCTATGCACCTGGGG + Intronic
963219682 3:142795197-142795219 AAAGAGTATCTGTGAACTTTGGG + Intronic
963443611 3:145373880-145373902 AAAGAGAATCTGTGCTCTCGAGG + Intergenic
963528856 3:146448009-146448031 AGAGAAAATCTGTGTGGTTGGGG - Intronic
963572033 3:147009401-147009423 AAAAAGAATCTGTGTGCTTGGGG - Intergenic
963659885 3:148112277-148112299 AGAAAGAGAATGTGCACTTGGGG + Intergenic
963701278 3:148629962-148629984 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
964151557 3:153531729-153531751 AGAGAGAATATGTGCACTTAGGG + Intergenic
964583013 3:158260890-158260912 AGACAGAATCTGTGCACTTGGGG - Intronic
964608292 3:158582242-158582264 GGAGAGAATCTCTGAGCTTGAGG + Intronic
964686662 3:159403463-159403485 AGAAAGAATTTGTGCAATAGGGG + Intronic
964961046 3:162427320-162427342 AGAGAGAATCTGCGTGCTTAGGG + Intergenic
964992181 3:162827972-162827994 AGAGAGAATCTGTGCCCTTGGGG + Intergenic
965020208 3:163218875-163218897 AGAGAGAATCTGTGTGCTTGAGG - Intergenic
965060256 3:163775586-163775608 AGAAAAAATCTGTGCACTTGAGG - Intergenic
965145114 3:164890838-164890860 AGAGAGAATTTATGTGCTTGCGG - Intergenic
965256980 3:166425727-166425749 AAAGAGAATCTATGCACTTGGGG + Intergenic
965322383 3:167265917-167265939 AGAGAGAATCTGTGCTCTCTGGG - Intronic
965350584 3:167607303-167607325 AGAGAGAAACTTTGCTCCTGAGG + Intronic
965379138 3:167966751-167966773 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
965415305 3:168385185-168385207 AGAGAGAGTCTGTGCTCTTGGGG - Intergenic
965547966 3:169934591-169934613 GGACAGAATCTGTGCTTTTGTGG + Intronic
965849092 3:173000773-173000795 AGAAAGAATCTCTGAGCTTGAGG - Intronic
965853937 3:173065674-173065696 AGAAAGAATCTGTGTGCTTGCGG + Intronic
965867139 3:173217624-173217646 ACAGAGTATCTGTGCACTTGAGG - Intergenic
966141825 3:176766275-176766297 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
966150994 3:176867812-176867834 AGAGAGGATCTGTGTGCTTGCGG + Intergenic
966861781 3:184234561-184234583 ACAGTGAAACTGGGCACTTGGGG + Intronic
967388036 3:188929482-188929504 AGACAGAATTTGTGAATTTGTGG - Intergenic
967983602 3:195079805-195079827 AGAGAGAATCTGTTTACAAGGGG + Intronic
968096039 3:195931492-195931514 AGAGAGAATCCGTGAGCTGGGGG + Intergenic
968096049 3:195931554-195931576 AGAGAGAATCCGTGTGCTGGGGG + Intergenic
968096060 3:195931616-195931638 AGAGAGAATCCGTGTGCTGGGGG + Intergenic
968096071 3:195931678-195931700 AGAGAGAATCCGTGTGCTGGGGG + Intergenic
968376688 4:49688-49710 TGAGAGTAGCTGTGCACTTTTGG + Intergenic
969830850 4:9795480-9795502 AGAGGGAATGTGGGGACTTGGGG - Intronic
970098079 4:12487471-12487493 AGAGAGAAACTGTGCATTTGGGG - Intergenic
970652755 4:18196742-18196764 AGAGAGAAGCTCTGCTTTTGTGG + Intergenic
970963228 4:21897935-21897957 AGGGAGAATCTGTGTGTTTGGGG + Intronic
972021540 4:34322458-34322480 ACAGAGAATCTGTGCCCTTGAGG + Intergenic
972067012 4:34960262-34960284 AGAGAAAATATGTTCACTCGAGG - Intergenic
972125404 4:35758955-35758977 AAAGAAAATCTGTGCACTTTGGG - Intergenic
972275372 4:37552338-37552360 GGACAGAAATTGTGCACTTGGGG + Intronic
972278574 4:37582090-37582112 AGAGAGCATCTGTGTGTTTGGGG - Intronic
972388215 4:38588083-38588105 AGAGAGAATGTGTGGATGTGTGG - Intergenic
973214506 4:47654495-47654517 ACAGAGAATCTGTGCACTTGTGG + Intronic
973707989 4:53598899-53598921 GGAAAGAATCTCTGCATTTGAGG + Intronic
973852655 4:54976735-54976757 AGGGAGAATCTGTGCACTTTGGG + Intergenic
974193295 4:58536122-58536144 AGAGATAATCTGTGTGCTTTTGG - Intergenic
974224363 4:59019251-59019273 AGAGAGAATCTGTGTGCTTGGGG - Intergenic
974266900 4:59597681-59597703 AGACAGAATCTGTGTGCTTGGGG + Intergenic
974290614 4:59925439-59925461 AGAGAGAATCTATGCCTTTGGGG + Intergenic
974415086 4:61595983-61596005 AGAGAGTATTTGTGCACTTTGGG - Intronic
974530918 4:63107142-63107164 AGGGAGAATCTGTGTTCCTGGGG + Intergenic
974808872 4:66920121-66920143 GGAAAGAATCTCTGAACTTGAGG - Intergenic
975314346 4:72933923-72933945 AGAGAGAATCTGTGTATTTAGGG - Intergenic
975502376 4:75100782-75100804 AGAGTGTTTCTGGGCACTTGGGG - Intergenic
975592903 4:76017879-76017901 AAAGATAATCTGTGTGCTTGGGG - Intronic
976030153 4:80742019-80742041 AGAGATAATCAGTGTACTTTTGG - Intronic
976172649 4:82319966-82319988 ATAGAGAGGCTGTGCATTTGTGG + Intergenic
976444006 4:85109724-85109746 AAAGAGAATCTGTGCACTTGAGG + Intergenic
976908187 4:90266642-90266664 AGAGAGAATCTGTGCTTCTGGGG + Intronic
976989891 4:91353224-91353246 GGACAGAAATTGTGCACTTGGGG - Intronic
977242667 4:94591897-94591919 AAAGAGAACCTGTGCAACTGAGG - Intronic
977307328 4:95341829-95341851 AGAGAGAATCTGTGTCCTTGGGG + Intronic
977325807 4:95573106-95573128 ACAGAGAACCTGTACACTTGGGG - Intergenic
977341440 4:95763740-95763762 AGAGAGAATCGGTGCACTCAAGG + Intergenic
977381122 4:96274874-96274896 ACAGAGAATCTGTGTGCTTGGGG - Intergenic
977527947 4:98166897-98166919 AGAGAGAATCTGTGCTCTTGAGG - Intergenic
977911272 4:102539821-102539843 AGATATAATGTGTGCATTTGGGG + Intronic
978082958 4:104616804-104616826 AGAGAGGATCTGTGTGCTTATGG - Intergenic
978258179 4:106718131-106718153 AGAAAGAATCTATGTGCTTGGGG + Intergenic
978733681 4:112061302-112061324 AGAGAGAATCTGTGCATTTGGGG + Intergenic
979111263 4:116761128-116761150 AGATAGAATCTGTGTGCCTGAGG + Intergenic
979396620 4:120197185-120197207 AGAGAGAATCTGTGCACTTTGGG + Intergenic
979565192 4:122146485-122146507 AAAAAGAATCTGTATACTTGGGG - Intergenic
979647331 4:123086784-123086806 GGAAAGAATCTCTGCACTTACGG - Intronic
979945721 4:126829511-126829533 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
980172532 4:129306641-129306663 AGAGAGAATCTGTGCACTTTGGG - Intergenic
980423461 4:132594033-132594055 TTAGAGAGACTGTGCACTTGTGG - Intergenic
980441899 4:132859266-132859288 ATAGAAAATCTCTTCACTTGTGG + Intergenic
980538282 4:134159470-134159492 AAAGAGAATCTGTGTGCTTTGGG + Intergenic
980596823 4:134965894-134965916 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
980675596 4:136075341-136075363 AGAGAGATACTGTGCAATAGCGG + Intergenic
980682799 4:136186530-136186552 AGAAAGAATCTCTGTACTTGGGG + Intergenic
980712635 4:136590647-136590669 TGGGAGAATCTGTGCATTTAGGG + Intergenic
980752907 4:137115728-137115750 AGGGAGAATCTGTGTTCTTGGGG + Intergenic
980800123 4:137736045-137736067 AGAGACAATCTGTGTGCTTGGGG - Intergenic
981106136 4:140884021-140884043 AGGAAGAATCAGTGAACTTGAGG - Intronic
981140117 4:141258653-141258675 AGAGAGAATCTCTGCACTTAGGG + Intergenic
981286453 4:143024549-143024571 GGAGAGACTCTTTCCACTTGAGG + Intergenic
981394592 4:144233231-144233253 AGAGAGAATCTGTTTGCTTCAGG + Intergenic
982247943 4:153373382-153373404 AGAGAAATTCTTTGCATTTGAGG + Intronic
982567907 4:157009679-157009701 AGTGAGAATCTGTACAGTTTGGG - Intergenic
982683492 4:158459966-158459988 AGAGAGAATCTGTGCACTTTGGG - Intronic
982719637 4:158846957-158846979 AAAGGGAATCTGTGCACTTGGGG + Intronic
982798120 4:159669296-159669318 AGAGAGAATCTATGTTTTTGGGG - Intergenic
982828408 4:160028298-160028320 GGAGAGAGTCTGTGCACTTGGGG - Intergenic
982888424 4:160814733-160814755 AGAGAGAAATTGTGCAGTTCTGG - Intergenic
983034854 4:162851321-162851343 GGACAGAAATTGTGCACTTGAGG - Intergenic
983338187 4:166422048-166422070 ACAGAGAGTCTGTGTACTTAAGG - Intergenic
983755374 4:171328626-171328648 AGAGAGAAGCTGTGTACTTGTGG + Intergenic
983844470 4:172499815-172499837 GGATAGAATCAGTGAACTTGAGG + Intronic
985229341 4:187798548-187798570 ATGGAGAATCTACGCACTTGGGG + Intergenic
986155917 5:5175837-5175859 AGACAGAATCTGTGTGATTGTGG - Intronic
986327000 5:6683485-6683507 AGAAAGGCTCTGTGCGCTTGCGG + Intergenic
986631309 5:9776270-9776292 AGAGAGAATCCATGCACTTGGGG - Intergenic
986756211 5:10839057-10839079 ATGGAGAATCTGTGCATTTAGGG + Intergenic
986885340 5:12226776-12226798 AGAGAGAATCTGTATGCTTGAGG - Intergenic
987017718 5:13837277-13837299 GGAGAGAAACTGTGCTTTTGAGG + Intronic
987106602 5:14645881-14645903 AGAGAAAATCAGTGCCATTGAGG - Intergenic
987564178 5:19563894-19563916 AGAGAGAATCTGTGCACTTTGGG + Intronic
987615997 5:20275853-20275875 AGAGAGAATATTTGCTTTTGGGG + Intronic
987675690 5:21070229-21070251 AGAGGGGATCTGTTCACTTGGGG - Intergenic
987886179 5:23815880-23815902 GGAGAGAATCTGTGTGCTTGGGG + Intergenic
987903771 5:24050004-24050026 AGAGAAAATCTGTGCACTTGTGG + Intronic
988019358 5:25604007-25604029 AAAGAGAATCAGTGAACCTGAGG + Intergenic
988082620 5:26433013-26433035 GTAGATAATCTGTTCACTTGGGG + Intergenic
988265433 5:28942690-28942712 AGAGAAAATCTGTGTCCTTGGGG - Intergenic
988931589 5:36040512-36040534 AGACAGAATCTGTGTGCTTAGGG + Intronic
989329972 5:40245617-40245639 ATGGAGAACCTGTGCACTTGTGG + Intergenic
989473039 5:41843007-41843029 AAAGAAAATTTGTGCATTTGAGG + Intronic
990202968 5:53398335-53398357 ATGGAGAATCTGTGCGCTTGGGG - Intergenic
990214398 5:53514355-53514377 GCAGAGAATCTGTGTGCTTGGGG - Intergenic
990531290 5:56675901-56675923 AGAGAGAAACTGTGCAGTGTGGG - Intergenic
990769693 5:59229129-59229151 AAAAAAAATCTCTGCACTTGTGG - Intronic
990896786 5:60708309-60708331 TGAGAGAAGCTATGCACATGTGG - Intergenic
990899842 5:60738545-60738567 ATAGAGAATCTGTGCACTTTAGG + Intergenic
991000369 5:61776822-61776844 AGAGAGAATCTGTGACTTTAAGG + Intergenic
991032683 5:62099130-62099152 AGAGAGAATATGAGCAAGTGTGG - Intergenic
991078552 5:62569208-62569230 AGACAGAAGCTGTGTGCTTGGGG - Intronic
991983384 5:72257337-72257359 AAAAATAATCTGAGCACTTGTGG - Intronic
992168752 5:74081256-74081278 AGAGAGAATCTCCGCATTTTAGG + Intergenic
992308938 5:75474279-75474301 GGACAGAAATTGTGCACTTGAGG + Intronic
992579325 5:78155266-78155288 ATGGAGAATCTCTGCACTAGGGG - Intronic
992657107 5:78921885-78921907 AGACAGAATCTGTGTTCTTGGGG + Intronic
992934412 5:81687167-81687189 ACGGAGAATCTGTGCCATTGTGG + Intronic
992989874 5:82273384-82273406 GGACAGAAATTGTGCACTTGAGG - Exonic
993026565 5:82653804-82653826 AAAGAGAATCTATGCACTTAGGG - Intergenic
993205669 5:84875448-84875470 AGAGAGTATCTGTGCATTTAGGG + Intergenic
993207161 5:84896028-84896050 AGAGAGAATCTTTGCACTTTGGG - Intergenic
993256976 5:85604447-85604469 AGAGAGAATCTGTGTCCTTGGGG + Intergenic
993388018 5:87282784-87282806 AGACAGAATCTGTGAACTTGAGG - Intronic
993932320 5:93954981-93955003 AGAGAGAATCTGTGCATTTGGGG - Intronic
994150989 5:96447280-96447302 AGAGAGCACCAGTGGACTTGAGG + Intergenic
994226043 5:97253147-97253169 ACAGAGAATCAGTGCACTTTGGG + Intergenic
994278455 5:97869106-97869128 AGAGAGAAGCTGAGCATTTCTGG + Intergenic
994881195 5:105498576-105498598 GGAGACAGTCTGTGCACTTTGGG - Intergenic
995019720 5:107352886-107352908 AGAGAGAATCTATGTGTTTGGGG - Intergenic
995044451 5:107629578-107629600 TGGGAGAAGCTGTGCACCTGTGG + Intronic
995265179 5:110151815-110151837 AGAGAGAATCTGTGTACTTTGGG + Intergenic
995268746 5:110195753-110195775 AGAGAGAATCTGTGCACTCAGGG - Intergenic
995290379 5:110444398-110444420 GTACAGAGTCTGTGCACTTGGGG - Intronic
995697912 5:114900413-114900435 GGAGAGAATCTGTGTGCTTGGGG - Intergenic
996128742 5:119755245-119755267 GGACAGAAACTGTGCATTTGGGG + Intergenic
996461166 5:123744664-123744686 GGAGAGAAAGTGTCCACTTGAGG + Intergenic
996944907 5:129055384-129055406 AGAGAGAATCTGTGCATTTAGGG + Intergenic
996956289 5:129187079-129187101 AGAGAGAATCTGTGTGCCTTGGG + Intergenic
997104506 5:131003900-131003922 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
997703712 5:135926804-135926826 AGAGAGAAACTTTGCTTTTGAGG + Intronic
998296360 5:140972979-140973001 AGGTAGATTCTGTGCATTTGTGG + Intronic
999902283 5:156097461-156097483 GGACAGAATCTCTGAACTTGAGG - Intronic
1000433406 5:161179286-161179308 AGAGAGAATCTATGCTGTTGGGG + Intergenic
1000517892 5:162262353-162262375 AGAGAGAATCTGCGTGCTTCAGG + Intergenic
1000942075 5:167373975-167373997 AAAGTGAATGTGTGCACATGGGG - Intronic
1001130907 5:169062711-169062733 AGGCAGAATCTGTGCTCTTATGG - Intronic
1001676196 5:173518657-173518679 AGAAATAATCTGTGCACGTATGG - Intergenic
1001845250 5:174916421-174916443 AGAGAGAATCTACGCACTTGGGG + Intergenic
1002009881 5:176270645-176270667 AGAGAGAATCTGTGTGCTTGGGG + Intronic
1002027695 5:176406550-176406572 AGAGAGGATCTGTGCAGAGGTGG + Intronic
1002216845 5:177641663-177641685 AGAGAGAATCTGTGTGCTTGGGG - Intergenic
1005037532 6:21570380-21570402 ACAGATAATCAGTGCACTTGAGG - Intergenic
1005279890 6:24262157-24262179 AGAGAGAATCTGTGTGCTTAGGG + Intronic
1006397772 6:33798279-33798301 AGACAAAATCTCTGCCCTTGTGG - Intronic
1006554379 6:34852989-34853011 AGACAGAATCCGTGTGCTTGGGG - Intronic
1007001775 6:38320104-38320126 AGAGAGAATCCGTGCATTTGGGG - Intronic
1007160081 6:39783925-39783947 AGACAGAATCACTGAACTTGAGG - Intergenic
1007960891 6:45957945-45957967 AGAGAGATTTTGAGCACTGGGGG + Intronic
1008073921 6:47126261-47126283 AGAAAGAATCTCTGAACTTGAGG - Intergenic
1008101152 6:47392519-47392541 AGAGAGATTCTATGTGCTTGGGG - Intergenic
1008192262 6:48474814-48474836 AGAAAGAATCTGTACACTCCGGG + Intergenic
1008240337 6:49102324-49102346 GGAGAAAATCTGTGTGCTTGGGG + Intergenic
1008289359 6:49694566-49694588 AGAGAGACACTGTCCACTTGGGG - Intronic
1008344985 6:50415516-50415538 AGAGTGAATCCTTGAACTTGTGG + Intergenic
1008822652 6:55651919-55651941 AGAGAGAATCTGTGCACTTTGGG - Intergenic
1009373634 6:62939398-62939420 AAAGAGAATCTGTACACCTAGGG - Intergenic
1009473095 6:64052803-64052825 AGAGAGAATGAGTGCAAGTGGGG - Intronic
1009687399 6:66980686-66980708 AGAAAGAATATGTCCACTTCTGG - Intergenic
1010018640 6:71134775-71134797 AGAGAGAATCTGTGCATTTTCGG + Intergenic
1011340888 6:86313195-86313217 AGAGAGAATCAGTATGCTTGCGG + Intergenic
1011343135 6:86339790-86339812 AGAGAAAATCTGTTTGCTTGGGG + Intergenic
1012028513 6:94028945-94028967 AGAGAGAATCTGTGCACTTGGGG + Intergenic
1012047720 6:94300379-94300401 AGAGAAAATTTGTGTGCTTGGGG + Intergenic
1012057117 6:94427176-94427198 AGAGAGAATCTGTGTGCTTGGGG - Intergenic
1012715199 6:102660363-102660385 AGAGAGAATCTGTTCACCTCGGG + Intergenic
1012827228 6:104162149-104162171 AGAAAGAAACTGTGTGCTTGGGG + Intergenic
1013114174 6:107088226-107088248 AAAAAGAATCTCTGCATTTGAGG + Intronic
1013364716 6:109428070-109428092 TGAGGGCATCTGTGCACATGAGG - Intronic
1013566129 6:111365650-111365672 AGACATAATCTCTGCCCTTGTGG + Intronic
1014378648 6:120711133-120711155 AGAGAGAATCTGTGCACTTGGGG + Intergenic
1014692326 6:124577376-124577398 AGCAAGAATCTGTGTGCTTGGGG + Intronic
1014794601 6:125710301-125710323 AGAGAGAATCTGACTGCTTGGGG + Intergenic
1015052930 6:128863681-128863703 AGAGAGAATCTGCGTTCTTTGGG - Intergenic
1015392782 6:132701824-132701846 AGAGAAAATTTGTGCCCTTGGGG + Intronic
1015460591 6:133487062-133487084 AGAGAGAATCTGTGCACTTGGGG + Intronic
1015578937 6:134702494-134702516 GGAGAGAATCTGAGCTCTTGCGG - Intergenic
1016054846 6:139567544-139567566 AGACAGCATCTGTGTGCTTGGGG - Intergenic
1016194517 6:141317528-141317550 AGAGAGAATCTGTGCCCTTGGGG + Intergenic
1016229678 6:141788255-141788277 AGAGAGAATCTGTGTGCCTGTGG + Intergenic
1016541373 6:145169944-145169966 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
1017006484 6:150031240-150031262 AGAAAGACTCATTGCACTTGAGG + Intergenic
1017464908 6:154685794-154685816 AGAGAGAATATGAGAACTTTTGG - Intergenic
1017924852 6:158901851-158901873 AGAGATGATCTGTGCACTTTGGG - Intronic
1018244906 6:161813547-161813569 AGAGAGAAAATGTGCACTGTAGG - Intronic
1018925406 6:168202352-168202374 AGAGCATATCTGAGCACTTGAGG + Intergenic
1019066299 6:169302182-169302204 AGAGACAATCTGTGTGCTTGGGG + Intergenic
1019702687 7:2481633-2481655 ACAGAGAATCTGCTCACTCGGGG + Intergenic
1020422637 7:8026594-8026616 GCACAGAATCTGTGCACTTTGGG + Intronic
1020485512 7:8715254-8715276 AGAGAGAACCTGGGCACCTGCGG - Intronic
1020574939 7:9914021-9914043 AGAGAGAATCTGTGTGCTTGAGG - Intergenic
1020755285 7:12193122-12193144 AGAGAGAATTTCTGCACATCTGG + Intergenic
1021123848 7:16827057-16827079 AGAGAGACTCTGTTTGCTTGTGG + Intronic
1021211789 7:17863008-17863030 AAAGAGAATCTGTGGGCTTGTGG + Intronic
1021214745 7:17901633-17901655 AGAGAAAATCTGTGCACTTAGGG - Intronic
1021884989 7:25129460-25129482 ATAGAGAATCAGTGTGCTTGCGG - Intergenic
1023240865 7:38146179-38146201 AGAGAGAATCTGTATGCTTGAGG + Intergenic
1023716134 7:43046279-43046301 AAACAGAATCTGTGTGCTTGGGG + Intergenic
1024078945 7:45839846-45839868 GGAGAGAATCTGTGGAGATGGGG - Intergenic
1024336539 7:48212272-48212294 AGAAAGATTCTGTGTGCTTGAGG - Intronic
1024369228 7:48560347-48560369 AGAGGGAATCTGTGCACTTGGGG - Intronic
1024371815 7:48594308-48594330 AAAAAAAATCTGTGAACTTGAGG - Intronic
1024662534 7:51511837-51511859 AGAAAGAATCTGTGAAATTGGGG - Intergenic
1024705962 7:51959809-51959831 AGGCAGAATCTGTGCACTTTGGG - Intergenic
1025061531 7:55812824-55812846 AGAGAGAATCTGTGTGTTTTGGG + Intronic
1025862071 7:65339513-65339535 AGAGAGAATTTGTGTGCTTAGGG - Intergenic
1026615474 7:71899085-71899107 AGAGAGAAGTTGTGTATTTGTGG - Intronic
1027258208 7:76444771-76444793 TGGGAGAATCTGTGCCCTGGGGG + Intergenic
1027280640 7:76607248-76607270 TGGGAGAATCTGTGCCCTGGGGG - Intergenic
1027523950 7:79244427-79244449 TGAGAGAGTCTGTGCAACTGGGG + Intronic
1027784486 7:82563396-82563418 AAAGAGAATTTGTGAACTAGTGG - Intergenic
1027921282 7:84399102-84399124 AAAGAGAATCTGTGTGCTTGGGG + Intronic
1028075533 7:86509336-86509358 AGACAAAATCTCTGCTCTTGTGG + Intergenic
1028115699 7:86995033-86995055 AAAGAGAATCTGAGTCCTTGAGG - Intronic
1028247991 7:88505734-88505756 AGAGAAAATCTGTGTATTTGGGG - Intergenic
1028266704 7:88734329-88734351 AATCAGAATCTGTGCACTTAGGG - Intergenic
1028299663 7:89181520-89181542 AGAAATAATCTGTGTGCTTGGGG - Intronic
1028353523 7:89879038-89879060 AGAGAGAATCTGTGTGCTTGGGG - Intergenic
1028420108 7:90623263-90623285 AGAGTGGATCTGTGCCCTTCTGG + Intronic
1028868184 7:95737116-95737138 AGAGAAAATTTGTGCCCTTGGGG - Intergenic
1028927094 7:96370076-96370098 GGAAAGAATCTCTGCACTTGAGG - Intergenic
1029531175 7:101126407-101126429 AGAGAGAGTCTGGACACGTGGGG + Intergenic
1030391404 7:108932236-108932258 AGAGAGAATCCCTGAGCTTGTGG - Intergenic
1030488756 7:110204839-110204861 GGAGACAGTCCGTGCACTTGCGG - Intergenic
1030775733 7:113531798-113531820 ATAAAGAATCTGTGAACTTGAGG + Intergenic
1030835162 7:114275400-114275422 GGACAGAATCTCTGCACTTGAGG - Intronic
1030966187 7:115995752-115995774 AGAGAGTATCTGTGCTCTTGGGG + Intronic
1030990222 7:116290825-116290847 AGAGAGAATCTGTATGCTTGAGG + Intronic
1031215322 7:118883070-118883092 AGAGAGAATTTGTGCGCTTTGGG + Intergenic
1031306145 7:120130296-120130318 AGAGAAAATCTGTGCACTTGGGG + Intergenic
1031353586 7:120763909-120763931 AGAGAGAATCTGTGTATTTAGGG - Intergenic
1031565833 7:123296149-123296171 AGAGAGAATCTGTATGCTTGGGG + Intergenic
1031657732 7:124379428-124379450 AGAGATAATCTGTGCACTTTGGG + Intergenic
1031721806 7:125186621-125186643 AGAGAGAATCTCTGTGCTTGGGG + Intergenic
1031862191 7:126993650-126993672 AAAGAGAATCTGTACACTTGGGG + Intronic
1032942346 7:136809759-136809781 AGAGAGAATCTGTGCACTTGGGG + Intergenic
1033502577 7:141966507-141966529 ATAGAGTATCTGTGTGCTTGAGG - Intronic
1034086783 7:148329136-148329158 AGACAGAATCTGTGGTCCTGGGG - Intronic
1034431614 7:151043924-151043946 AGCCTGAAGCTGTGCACTTGAGG - Intronic
1034989659 7:155540183-155540205 GGAGAGGCTCTCTGCACTTGGGG + Intergenic
1035138973 7:156738151-156738173 AGAGAGAATCTGTGTACTTGGGG + Intronic
1035851674 8:2925510-2925532 ACAAAGAATCTGTGTAATTGAGG + Intergenic
1037295516 8:17396415-17396437 AAAAAGAATCTGTGCACTTGCGG + Intronic
1039755486 8:40517887-40517909 AGAGAAAGTATGTACACTTGAGG + Intergenic
1039897652 8:41727622-41727644 AGAGAGAAACTGAGGACTGGGGG - Intronic
1040422097 8:47250332-47250354 AGAAGGAATCTCTGAACTTGAGG - Intergenic
1040485611 8:47868844-47868866 ACACAGAAGCTGTGCACTTGGGG + Intronic
1040721107 8:50324294-50324316 AGACAGAATCTGTGCATCTTGGG - Intronic
1040743241 8:50605567-50605589 AGAGAGAATCTGTGCACTTGGGG - Intronic
1040745524 8:50636590-50636612 GGAGAGAATCTGTGCTCTTTGGG - Intronic
1041305389 8:56452223-56452245 GGAAAGAATCTCTGGACTTGGGG + Intergenic
1041415886 8:57608715-57608737 AAAGGGAATCTGTGTGCTTGGGG + Intergenic
1041580020 8:59447697-59447719 AGAGAGAATCTGTGCACTTTGGG - Intergenic
1041582965 8:59483869-59483891 AGAAAGAATCTGTGCACTTCGGG - Intergenic
1041606821 8:59792011-59792033 AGAGAGAATCTGTCTGCTTGGGG + Intergenic
1041640482 8:60194534-60194556 AGAGAGAGACTCTGTACTTGGGG - Intronic
1041744885 8:61197902-61197924 AGGAAGAGTCTGTGCACTTTGGG - Intronic
1041818691 8:62004002-62004024 GGATAGAATCAGTGAACTTGAGG + Intergenic
1042032446 8:64491152-64491174 AGAGAGAATCTGTCCACTTTGGG + Intergenic
1042034724 8:64519594-64519616 AGAGAGAAACTCTGCACTTAGGG - Intergenic
1042162516 8:65911796-65911818 AGAGAAAATCTGTGTGCTTGGGG + Intergenic
1042428069 8:68672437-68672459 AGAGAGAATCTGTGGGCTTAGGG + Intronic
1043041967 8:75275198-75275220 AGAGAGAATCTGTGCACCTGGGG + Intergenic
1043567196 8:81561615-81561637 AGATAGAATCTGTGTGCATGGGG + Intergenic
1043600219 8:81928594-81928616 GGAGAGAATCTGTGTACTCTGGG + Intergenic
1044066142 8:87702818-87702840 AGAGAGAATGTTTGCCCTTAGGG + Intergenic
1044124160 8:88437318-88437340 AGAGAGAATCTGTGCACTTAGGG + Intergenic
1044635554 8:94320229-94320251 AGAGAGAATCTGTGTGCTCAGGG - Intergenic
1045041431 8:98228058-98228080 ACAGAGAATCTGCACACTCGGGG - Intronic
1045172664 8:99687658-99687680 AGAGAGAATCTGTGCATTTGTGG - Intronic
1045599099 8:103693209-103693231 GAAGAGAATCTGTGAACTTATGG - Intronic
1045738311 8:105321012-105321034 AGTGATAATCTGTGCAAATGTGG + Intronic
1046448542 8:114357896-114357918 AGAAAGAATCTGTGACCTTGAGG + Intergenic
1047138488 8:122107901-122107923 AGTGAGAATCTGTGCACCTGGGG - Intergenic
1047342934 8:124000200-124000222 AAAGAAAATCTGAGCACTTGGGG - Intronic
1047352543 8:124089335-124089357 AGAGAGGATCTGTGCACTTAGGG - Intronic
1050238939 9:3613658-3613680 AGAGAGAATCAGTGCACTTGAGG - Intergenic
1050248056 9:3712981-3713003 AGAGAGAATCTGTGCACTTTGGG + Intergenic
1050464461 9:5906977-5906999 AGAGAAAAACTGTGAACCTGTGG + Exonic
1050508095 9:6368392-6368414 GGAGAGAATCTGTGCACTTGAGG + Intergenic
1050930280 9:11313467-11313489 AGAGAGAATCTGAATACTTGGGG - Intergenic
1051229917 9:14945355-14945377 ACTGAGAATCTGTGCTCTTGGGG + Intergenic
1051246449 9:15116604-15116626 TGAGAATATCTGTGCACTTTTGG - Intergenic
1051306614 9:15717157-15717179 GGGGGGAATCTGTGCACTTGGGG + Intronic
1051446288 9:17142650-17142672 CGAGTGAATCTGTGCACTCTGGG - Intronic
1051469709 9:17423832-17423854 AGAGAGAATCTGTGTGCTTGGGG - Intronic
1051991968 9:23162676-23162698 AGAGATAGTCTGTAAACTTGGGG + Intergenic
1052205023 9:25828541-25828563 AGAGAGAATCTGTGCACTTTGGG - Intergenic
1052442673 9:28517882-28517904 AGAGTGAATCAAAGCACTTGTGG - Intronic
1052842673 9:33306436-33306458 AGAGAGAAAATGTGGATTTGGGG + Intronic
1053342613 9:37350566-37350588 ATAGGGAATCTGGGCATTTGTGG - Intronic
1054702148 9:68423614-68423636 AGAGAGATTTTGTGCTCTTGGGG - Intronic
1054761183 9:69005747-69005769 AGAGAGGACTTGGGCACTTGTGG - Intronic
1054982459 9:71222733-71222755 AAAGAGAATCTGTGTGCTTGGGG + Intronic
1055910958 9:81350625-81350647 AGAGAGAATCTGTGCACTTTGGG + Intergenic
1056039698 9:82651026-82651048 AAAAAGAATCTGTGAACTTGAGG - Intergenic
1056230698 9:84539752-84539774 AGAGAGAATCTGTGCAACTTGGG - Intergenic
1057084506 9:92196662-92196684 AGAGAGAATCTATGTTCTTGGGG + Intergenic
1057241229 9:93411800-93411822 AGAGACAATCTGTATGCTTGGGG - Intergenic
1057289189 9:93789638-93789660 ATGGAGAATCTGTGCACTTAGGG - Intergenic
1058003829 9:99894989-99895011 AGAGAGAATCTGTATGCCTGGGG + Intergenic
1058522922 9:105829466-105829488 AGACAGAATCTGTGAACTTGGGG - Intergenic
1058820769 9:108727655-108727677 AGACAGAATCTTTGCACTTGTGG + Intergenic
1059838966 9:118191176-118191198 AGAGAGAATCTGTACGCTTGAGG + Intergenic
1059900728 9:118922137-118922159 AGACAGAATCTCTGTGCTTGGGG - Intergenic
1060328582 9:122643279-122643301 AGAGAGAATATGTGCACTGTGGG + Intergenic
1060375929 9:123115185-123115207 AGAGAGAGTGTGCCCACTTGGGG - Intronic
1062180876 9:135190396-135190418 AGTGAGGGTCTGTGCACATGGGG - Intergenic
1203572542 Un_KI270744v1:144558-144580 TGAGAGTAGCTGTGCACTTTTGG - Intergenic
1186525503 X:10244493-10244515 AGTGAAAATCTGTGCACATCTGG + Intergenic
1186602264 X:11050327-11050349 AAAGAGAATCTGTGCACTTGGGG - Intergenic
1186886112 X:13915340-13915362 AGAGAGAATAGGGGAACTTGTGG - Intronic
1187282961 X:17875714-17875736 AGATAGAATCAGTGAACTTCAGG - Intergenic
1187575130 X:20546019-20546041 AGAGAGAATCTGTCTGCTTGGGG - Intergenic
1187579426 X:20592530-20592552 AGAGAGAATCTGTGCATGCTGGG - Intergenic
1188112795 X:26212056-26212078 AGAGAGAATCTGTGCACTGTGGG - Intergenic
1188421232 X:29992542-29992564 AGAGAGAATCTGTGGACTTGCGG - Intergenic
1188625193 X:32276041-32276063 AGAGGGAATCTTTGCACTTTTGG + Intronic
1188716551 X:33465489-33465511 AGAGAGAATCTGTGTGCTTAGGG - Intergenic
1188864545 X:35299426-35299448 AGAGAGAACCCATGCACTTGAGG + Intergenic
1188897340 X:35685797-35685819 AGAGCGAATCTGTATACTTGAGG + Intergenic
1188917984 X:35935395-35935417 AGAGAGAATCTGTGCATTTGAGG - Intronic
1189038013 X:37512654-37512676 AGAGAGAAACTGGCCACTGGGGG - Intronic
1189628046 X:42920713-42920735 AGAGAAAATCTGTGTACTGGGGG + Intergenic
1189640646 X:43067425-43067447 AAAGCAAATCTGTGCACTTGTGG + Intergenic
1189854240 X:45208162-45208184 AGAGAGAATCTGTGTCCTTGGGG - Intergenic
1189854524 X:45210235-45210257 AGAGAGAATCTGTGTGCTTAGGG - Intergenic
1189875799 X:45434532-45434554 AGAAAGAATCTGTGTACTTGGGG - Intergenic
1189934010 X:46046014-46046036 GGAAAGAATCTCTGAACTTGAGG + Intergenic
1190046072 X:47112478-47112500 AGAGAGAATCTGTGCACTTGGGG + Intergenic
1190122601 X:47674573-47674595 AGAGAGAATCTGTGTGCTTGAGG - Intergenic
1190374474 X:49775475-49775497 AGAGAGAATCTGTGAACTTGCGG - Intergenic
1190522897 X:51298411-51298433 AGAGAGAATCTGTGCATGTGGGG + Intergenic
1190588242 X:51968541-51968563 ATGGAGACTCTGTGCACTTGGGG - Intergenic
1190602760 X:52109158-52109180 AGAGAGAATCTCTGTACTTAGGG - Intergenic
1190808476 X:53861693-53861715 AGGGACAATCTGTGTGCTTGGGG - Intergenic
1190920201 X:54843681-54843703 GGAGAGCATCAGTGAACTTGAGG + Intergenic
1191179053 X:57540092-57540114 AGAGAGAATCCATGCACTTGGGG + Intergenic
1191197054 X:57736003-57736025 AGAGAGAGTCTGTGCATTTTGGG + Intergenic
1191760087 X:64637060-64637082 AGAGAGAATCTGTGTAATTTAGG - Intergenic
1191812500 X:65204061-65204083 AGAGAGAGAATGTGCATTTGAGG - Intergenic
1191813349 X:65216293-65216315 AGAGAGTATATGTGTGCTTGAGG + Intergenic
1191930192 X:66364302-66364324 ACTGAGAGTCTGTGCACTTTCGG + Intergenic
1191947027 X:66545380-66545402 AGTGAGAATCTGTGCATTTGTGG - Intergenic
1191952770 X:66611588-66611610 TGATAGAATCAGTGAACTTGAGG + Intronic
1192020340 X:67384509-67384531 AGAGAGAATCTGTGCACATGAGG + Intergenic
1192677957 X:73219578-73219600 AGAGAGAATCTGTACACTCTAGG + Intergenic
1193052509 X:77116091-77116113 GGAGAGAATCTGTGTACTTGGGG - Intergenic
1193052540 X:77116289-77116311 CAGGATAATCTGTGCACTTGGGG - Intergenic
1193098218 X:77578016-77578038 GGAGAGAATCAGTGCACTTGCGG + Intronic
1193191230 X:78573320-78573342 AGAGAGAATCTGTGCATTTGGGG - Intergenic
1193194953 X:78620408-78620430 AAAGAAAATCTGTGTGCTTGGGG - Intergenic
1193335578 X:80285011-80285033 AGAGAGAATCTGTCTGCTTGGGG + Intergenic
1193366833 X:80644379-80644401 AGAGAGAATCTATGCACTTGGGG - Intergenic
1193580365 X:83257081-83257103 AGAGTGAATGTGTGCACTTTGGG + Intergenic
1193652351 X:84152683-84152705 AGAAATAAACTGTGAACTTGAGG + Intronic
1193658343 X:84225252-84225274 AGAGAGAATCTATGTACTTGTGG - Intergenic
1193675977 X:84453392-84453414 AGAAAAAGTCTGTGCACTTAGGG + Intronic
1193738356 X:85186658-85186680 AAAGAAAATCTGTGTACTTAGGG - Intergenic
1193742236 X:85231609-85231631 AGAGAGAACTTGTGTGCTTGGGG + Intergenic
1193750519 X:85337295-85337317 AGAGAGAATCTGTGTGCTTGAGG - Intronic
1193764643 X:85512162-85512184 AGAGAGAATGAATGTACTTGAGG - Intergenic
1193912139 X:87318281-87318303 AGAGAGAATCTGTGGCTTGGGGG - Intergenic
1194095642 X:89636000-89636022 AGAAAGAATCTGTGCACTTGGGG + Intergenic
1194220031 X:91178258-91178280 AGAGAGAATCTGTGCACTTTGGG - Intergenic
1194257617 X:91653517-91653539 AGAGAGAATCTGTGCACTTGTGG - Intergenic
1194291168 X:92073123-92073145 AGAAAGAATATGTGCATTTTGGG - Intronic
1194327797 X:92541376-92541398 ACAGAGAGTTTGTGCACTTGGGG - Intronic
1194329114 X:92559624-92559646 AAAGAGAAACTGTGCACTTTAGG + Intronic
1194387675 X:93277545-93277567 AGAGAAAATCTGTGTGCTTGGGG + Intergenic
1194398087 X:93411428-93411450 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
1194415373 X:93605710-93605732 AAAGATAATCTGTGCACTTTTGG + Intergenic
1194462492 X:94189452-94189474 AGTGAGAATCTGGGCATGTGTGG - Intergenic
1194466543 X:94240759-94240781 AGTGAGAATCTGTGTGCTTGGGG - Intergenic
1194479467 X:94401937-94401959 AGAAAGAATCTGTGCACTTTGGG - Intergenic
1194693045 X:97010268-97010290 AGACAGATTCTATGCACTTTGGG - Intronic
1194842084 X:98754845-98754867 AGAGAGAAACTGTGTACTTATGG - Intergenic
1194937745 X:99971148-99971170 AGAGAGATTCTGTGTTCTTGGGG - Intergenic
1195028787 X:100906169-100906191 AGAGGGAGGCTATGCACTTGTGG - Intergenic
1195158563 X:102148213-102148235 AGAGAGAATCAGTGAGCTTGAGG - Intergenic
1195199239 X:102532109-102532131 AGAGGGAATCTGTGCACTTTGGG + Intergenic
1195396038 X:104411645-104411667 GAGGTGAATCTGTGCACTTGGGG + Intergenic
1195406641 X:104521879-104521901 GGATAGAATCAGTGAACTTGGGG - Intergenic
1195595326 X:106682681-106682703 ACAGAGAATCTGTGTGCATGGGG + Intergenic
1195715565 X:107815014-107815036 AGACAAAATCTCTGCTCTTGTGG + Intergenic
1195825047 X:108990568-108990590 AAAGAGAATCTGTGTGCTTGAGG - Intergenic
1195872249 X:109498641-109498663 AGAGATAATCTGTGCACTTGGGG - Intergenic
1196234603 X:113263349-113263371 AGAGAAAATCTGTGTGCTTGAGG - Intergenic
1196256405 X:113524395-113524417 ACAAAGAGTATGTGCACTTGAGG - Intergenic
1196264458 X:113626099-113626121 AGAGAGACTCCTTCCACTTGGGG - Intergenic
1196290130 X:113930094-113930116 ATAGAGAATCTGTATGCTTGGGG - Intergenic
1196312263 X:114182979-114183001 AGAAAGAATCTCTGAGCTTGAGG + Intergenic
1196485711 X:116204187-116204209 AGAGAGAATCTATGCGCTTTGGG - Intergenic
1196485835 X:116205681-116205703 AGAAAGAATCAGTAAACTTGAGG + Intergenic
1196639129 X:118038474-118038496 AGGGAGAATCTGTGCACTAGAGG + Intronic
1196861824 X:120035911-120035933 GGACAGAAACTGTGCACTCGAGG - Intergenic
1197072820 X:122321331-122321353 AGAGAGAATTTATGCATTTTGGG + Intergenic
1197177957 X:123504756-123504778 AGAAAGAATCTGTGCCCTTGGGG + Intergenic
1197361243 X:125505615-125505637 AGAGAGAATCTGTACACTTCAGG - Intergenic
1197375879 X:125681714-125681736 AGAGAGCATCTGTGTACCTGGGG + Intergenic
1197382866 X:125766471-125766493 AGAGAGAATATGTACACTTCAGG - Intergenic
1197399866 X:125977332-125977354 AGAGAGAATCTGTGTGCTTGGGG + Intergenic
1197457897 X:126700955-126700977 AGAGAGAATCTCTGCACTTTGGG + Intergenic
1197481632 X:126994205-126994227 AGAGAGAATCTGTGTGCTTTGGG + Intergenic
1197487858 X:127075485-127075507 AGAAAGAATCTGTGTGCTTGGGG - Intergenic
1197894280 X:131294534-131294556 AGAGAGAATCAGTACAAATGAGG - Intronic
1198274128 X:135085549-135085571 AGAGAGAATCTGTGCACTTGGGG - Intergenic
1198559267 X:137830990-137831012 AGACAGAATCTGTGCACTTTGGG + Intergenic
1198614178 X:138436542-138436564 AGAAAGTATGTGTGAACTTGAGG - Intergenic
1198761554 X:140038321-140038343 AAAGAGAATCTGTGTCCTTTGGG + Intergenic
1198770689 X:140126927-140126949 AGAGAGAATCTGTGCACTTGGGG - Intergenic
1198828934 X:140728398-140728420 AGAGTGATTTTGTGCATTTGGGG - Intergenic
1199162512 X:144629659-144629681 AGAAAGAATCAGTGAGCTTGAGG + Intergenic
1199306468 X:146272710-146272732 AGAGAGAATTTGTGTACTTAGGG - Intergenic
1199989480 X:152977871-152977893 ACAGACAATCTGTGAATTTGTGG + Intergenic
1200177199 X:154125509-154125531 AGAGAGAAGCTGTACACTTGGGG + Intergenic
1200370096 X:155715891-155715913 TGAGAGAATCTTTGCACTTTGGG - Intergenic
1200379422 X:155819372-155819394 AGAGAGAATTTGTGTGCTTGGGG + Intergenic
1200448641 Y:3297368-3297390 AGAAAGAATCTGTGCACTTGGGG + Intergenic
1200556542 Y:4642019-4642041 AGAGAGAATCTGTGCACTTTGGG - Intergenic
1200576275 Y:4892463-4892485 AGAGAGAATCTGTGCACTTGTGG - Intergenic
1200608676 Y:5297698-5297720 AGAAAGAATATGTGCATTTTGGG - Intronic
1200636511 Y:5660594-5660616 ACAGAGAGTTTGTGCACTTGGGG - Intronic
1200637816 Y:5678814-5678836 AAAGAGAAACTGTGCACTTTAGG + Intronic
1201955818 Y:19621355-19621377 AGAAAGAGTCTGCACACTTGGGG + Intergenic
1201979505 Y:19891809-19891831 AGGGAGAATCTGTACACTTTGGG + Intergenic
1202587397 Y:26446107-26446129 AGTGAGAATTTGGGCAGTTGAGG + Intergenic