ID: 1014378650

View in Genome Browser
Species Human (GRCh38)
Location 6:120711155-120711177
Sequence GACGGAGAGTCCACTGATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014378645_1014378650 23 Left 1014378645 6:120711109-120711131 CCTTGGCAGTGGCACATGACATG No data
Right 1014378650 6:120711155-120711177 GACGGAGAGTCCACTGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014378650 Original CRISPR GACGGAGAGTCCACTGATTG TGG Intergenic
No off target data available for this crispr