ID: 1014378651

View in Genome Browser
Species Human (GRCh38)
Location 6:120711156-120711178
Sequence ACGGAGAGTCCACTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014378645_1014378651 24 Left 1014378645 6:120711109-120711131 CCTTGGCAGTGGCACATGACATG No data
Right 1014378651 6:120711156-120711178 ACGGAGAGTCCACTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014378651 Original CRISPR ACGGAGAGTCCACTGATTGT GGG Intergenic
No off target data available for this crispr