ID: 1014382301

View in Genome Browser
Species Human (GRCh38)
Location 6:120757727-120757749
Sequence AATCAGATGAAACTACTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014382301_1014382304 30 Left 1014382301 6:120757727-120757749 CCAGACAGTAGTTTCATCTGATT No data
Right 1014382304 6:120757780-120757802 CATGACTTTAATACTATTTCTGG No data
1014382301_1014382302 -9 Left 1014382301 6:120757727-120757749 CCAGACAGTAGTTTCATCTGATT No data
Right 1014382302 6:120757741-120757763 CATCTGATTTTCCAAGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014382301 Original CRISPR AATCAGATGAAACTACTGTC TGG (reversed) Intergenic
No off target data available for this crispr