ID: 1014388570

View in Genome Browser
Species Human (GRCh38)
Location 6:120832119-120832141
Sequence AAGGGTCTCTTGAGCTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014388562_1014388570 11 Left 1014388562 6:120832085-120832107 CCTGTGGTCTCAGCTACTCAGGA 0: 363
1: 7447
2: 61326
3: 181370
4: 227197
Right 1014388570 6:120832119-120832141 AAGGGTCTCTTGAGCTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014388570 Original CRISPR AAGGGTCTCTTGAGCTCAGG AGG Intergenic
No off target data available for this crispr