ID: 1014391791

View in Genome Browser
Species Human (GRCh38)
Location 6:120873185-120873207
Sequence CTGTGGGGCTCTGTGGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014391782_1014391791 2 Left 1014391782 6:120873160-120873182 CCCTGAGCCAGGGCTGTGACACC 0: 59
1: 129
2: 242
3: 281
4: 507
Right 1014391791 6:120873185-120873207 CTGTGGGGCTCTGTGGCTCCTGG No data
1014391778_1014391791 17 Left 1014391778 6:120873145-120873167 CCAAACCTAAGAGCTCCCTGAGC No data
Right 1014391791 6:120873185-120873207 CTGTGGGGCTCTGTGGCTCCTGG No data
1014391780_1014391791 12 Left 1014391780 6:120873150-120873172 CCTAAGAGCTCCCTGAGCCAGGG No data
Right 1014391791 6:120873185-120873207 CTGTGGGGCTCTGTGGCTCCTGG No data
1014391783_1014391791 1 Left 1014391783 6:120873161-120873183 CCTGAGCCAGGGCTGTGACACCC 0: 64
1: 184
2: 271
3: 295
4: 552
Right 1014391791 6:120873185-120873207 CTGTGGGGCTCTGTGGCTCCTGG No data
1014391777_1014391791 29 Left 1014391777 6:120873133-120873155 CCTTTGGGGAGTCCAAACCTAAG No data
Right 1014391791 6:120873185-120873207 CTGTGGGGCTCTGTGGCTCCTGG No data
1014391784_1014391791 -5 Left 1014391784 6:120873167-120873189 CCAGGGCTGTGACACCCTCTGTG No data
Right 1014391791 6:120873185-120873207 CTGTGGGGCTCTGTGGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014391791 Original CRISPR CTGTGGGGCTCTGTGGCTCC TGG Intergenic
No off target data available for this crispr