ID: 1014400322

View in Genome Browser
Species Human (GRCh38)
Location 6:120981045-120981067
Sequence CTGCAGATTCCAAGGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014400317_1014400322 1 Left 1014400317 6:120981021-120981043 CCTAGGGGTTCTGCAACCAATCC No data
Right 1014400322 6:120981045-120981067 CTGCAGATTCCAAGGGACAATGG No data
1014400316_1014400322 2 Left 1014400316 6:120981020-120981042 CCCTAGGGGTTCTGCAACCAATC No data
Right 1014400322 6:120981045-120981067 CTGCAGATTCCAAGGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014400322 Original CRISPR CTGCAGATTCCAAGGGACAA TGG Intergenic
No off target data available for this crispr