ID: 1014403184

View in Genome Browser
Species Human (GRCh38)
Location 6:121015948-121015970
Sequence GTGGCCTCGCTTATCATTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014403184_1014403188 18 Left 1014403184 6:121015948-121015970 CCAGGAATGATAAGCGAGGCCAC No data
Right 1014403188 6:121015989-121016011 CAGTTCACAAGTACTGATGTTGG No data
1014403184_1014403189 24 Left 1014403184 6:121015948-121015970 CCAGGAATGATAAGCGAGGCCAC No data
Right 1014403189 6:121015995-121016017 ACAAGTACTGATGTTGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014403184 Original CRISPR GTGGCCTCGCTTATCATTCC TGG (reversed) Intergenic
No off target data available for this crispr