ID: 1014404920

View in Genome Browser
Species Human (GRCh38)
Location 6:121039523-121039545
Sequence AAGTTTTTAAAGATGGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014404918_1014404920 -6 Left 1014404918 6:121039506-121039528 CCTTGCGGTGAGTGTTAAAGTTT No data
Right 1014404920 6:121039523-121039545 AAGTTTTTAAAGATGGTGTCTGG No data
1014404916_1014404920 2 Left 1014404916 6:121039498-121039520 CCGCAGACCCTTGCGGTGAGTGT 0: 25
1: 247
2: 869
3: 1198
4: 1089
Right 1014404920 6:121039523-121039545 AAGTTTTTAAAGATGGTGTCTGG No data
1014404917_1014404920 -5 Left 1014404917 6:121039505-121039527 CCCTTGCGGTGAGTGTTAAAGTT No data
Right 1014404920 6:121039523-121039545 AAGTTTTTAAAGATGGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014404920 Original CRISPR AAGTTTTTAAAGATGGTGTC TGG Intergenic
No off target data available for this crispr