ID: 1014405332

View in Genome Browser
Species Human (GRCh38)
Location 6:121043749-121043771
Sequence CGGCACACAGACGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014405332_1014405340 23 Left 1014405332 6:121043749-121043771 CCTTCCACCTCGTCTGTGTGCCG No data
Right 1014405340 6:121043795-121043817 TTTCCTCTGCCTCTGCACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014405332 Original CRISPR CGGCACACAGACGAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr