ID: 1014406031

View in Genome Browser
Species Human (GRCh38)
Location 6:121052347-121052369
Sequence CTGTGTTCATGGAGGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014406031_1014406036 19 Left 1014406031 6:121052347-121052369 CCTGTCTCCCTCCATGAACACAG No data
Right 1014406036 6:121052389-121052411 TGCATGAAGCAGCTGTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014406031 Original CRISPR CTGTGTTCATGGAGGGAGAC AGG (reversed) Intergenic
No off target data available for this crispr