ID: 1014416987

View in Genome Browser
Species Human (GRCh38)
Location 6:121195399-121195421
Sequence GACAGCTCTTGGCATGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014416982_1014416987 16 Left 1014416982 6:121195360-121195382 CCCTACCATCTTCTGCAGATAAC 0: 7
1: 193
2: 178
3: 130
4: 224
Right 1014416987 6:121195399-121195421 GACAGCTCTTGGCATGTTACTGG No data
1014416983_1014416987 15 Left 1014416983 6:121195361-121195383 CCTACCATCTTCTGCAGATAACC 0: 1
1: 21
2: 210
3: 201
4: 221
Right 1014416987 6:121195399-121195421 GACAGCTCTTGGCATGTTACTGG No data
1014416985_1014416987 -6 Left 1014416985 6:121195382-121195404 CCACTCTACTTCTGAGAGACAGC 0: 1
1: 0
2: 5
3: 21
4: 193
Right 1014416987 6:121195399-121195421 GACAGCTCTTGGCATGTTACTGG No data
1014416984_1014416987 11 Left 1014416984 6:121195365-121195387 CCATCTTCTGCAGATAACCACTC 0: 5
1: 190
2: 196
3: 119
4: 360
Right 1014416987 6:121195399-121195421 GACAGCTCTTGGCATGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014416987 Original CRISPR GACAGCTCTTGGCATGTTAC TGG Intronic
No off target data available for this crispr