ID: 1014420949

View in Genome Browser
Species Human (GRCh38)
Location 6:121245086-121245108
Sequence CACCACTGCCTGCAACACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014420946_1014420949 14 Left 1014420946 6:121245049-121245071 CCTAGGAAGGAGAAAATGGCTGT No data
Right 1014420949 6:121245086-121245108 CACCACTGCCTGCAACACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014420949 Original CRISPR CACCACTGCCTGCAACACCC TGG Intronic