ID: 1014421056

View in Genome Browser
Species Human (GRCh38)
Location 6:121245803-121245825
Sequence ACATTCCCACAGATGAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 2, 1: 10, 2: 34, 3: 87, 4: 324}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014421054_1014421056 -6 Left 1014421054 6:121245786-121245808 CCCTACTTGAAACATCAACATTC 0: 1
1: 18
2: 20
3: 28
4: 215
Right 1014421056 6:121245803-121245825 ACATTCCCACAGATGAAAAGAGG 0: 2
1: 10
2: 34
3: 87
4: 324
1014421055_1014421056 -7 Left 1014421055 6:121245787-121245809 CCTACTTGAAACATCAACATTCC 0: 1
1: 15
2: 19
3: 67
4: 181
Right 1014421056 6:121245803-121245825 ACATTCCCACAGATGAAAAGAGG 0: 2
1: 10
2: 34
3: 87
4: 324
1014421053_1014421056 23 Left 1014421053 6:121245757-121245779 CCTGCACAAGAGGGAGAGTGACT 0: 1
1: 0
2: 0
3: 20
4: 171
Right 1014421056 6:121245803-121245825 ACATTCCCACAGATGAAAAGAGG 0: 2
1: 10
2: 34
3: 87
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014421056 Original CRISPR ACATTCCCACAGATGAAAAG AGG Intronic
900296444 1:1954013-1954035 ACAATCCCACAGAAGAACAAGGG + Intronic
901107592 1:6769381-6769403 ACATTCACACAGAAGATAAAGGG - Intergenic
906875222 1:49530433-49530455 ATATTTCCACATATAAAAAGAGG - Intronic
907257209 1:53188803-53188825 ACATTCCCAGATATGGAAATAGG + Intergenic
909227679 1:73045670-73045692 ACATTCCTACAGAAGAAGAGAGG + Intergenic
909355880 1:74709295-74709317 ATATTCACAAAGATGAAAAATGG - Intronic
909370658 1:74879519-74879541 AGATTCCCACACATTAATAGTGG + Intergenic
910106906 1:83641608-83641630 ACATTCCAGAAGCTGAAAAGTGG + Intergenic
910909181 1:92215751-92215773 ATATACCCAGAGAAGAAAAGAGG + Intergenic
911506173 1:98754915-98754937 AAATGCCTACACATGAAAAGAGG - Intronic
911794132 1:102054940-102054962 ATACTTCTACAGATGAAAAGAGG + Intergenic
911944266 1:104086155-104086177 ACATTCACACAGCTGCTAAGGGG + Intergenic
912028303 1:105206151-105206173 ACATTACTTCAGATGAAAAGAGG + Intergenic
912121250 1:106474299-106474321 ACATTCCTATAGACAAAAAGAGG + Intergenic
913588150 1:120296728-120296750 ACAATCCCACAGACTAGAAGGGG - Intergenic
913620035 1:120601641-120601663 ACAATCCCACAGACTAGAAGGGG + Intergenic
914570167 1:148908601-148908623 ACAATCCCACAGACTAGAAGGGG - Intronic
914602661 1:149221668-149221690 ACAATCCCACAGACTAGAAGGGG + Intergenic
915803519 1:158819580-158819602 ACAATCCCACACACAAAAAGAGG + Intergenic
916868758 1:168888859-168888881 ACACTCCTACAGATGAAAAGAGG + Intergenic
916964819 1:169927371-169927393 AAATTGCTACAGAAGAAAAGAGG + Intronic
919242298 1:194930598-194930620 AGTTTGCCACAGATGACAAGTGG + Intergenic
919430729 1:197487938-197487960 ACATTCTTATAGATGAAAAGAGG + Intergenic
919491824 1:198213606-198213628 GCATTCCTGCAGATGAAAAGAGG + Intronic
920943555 1:210506667-210506689 AAATACCCACAGATAAAAATAGG - Intronic
921813825 1:219544662-219544684 ACATTCCTGCAGATGAAAAGAGG + Intergenic
922617383 1:226969593-226969615 ACTTTCACAGAGATGAAAAGAGG - Intronic
923910140 1:238431941-238431963 ACATTCCTGCAAATGAAAAGAGG + Intergenic
924083200 1:240420763-240420785 ACATTCCCACACAGGACAGGGGG + Intronic
924193213 1:241577999-241578021 ACATTCCTGCAGATGGAAAGAGG - Intronic
924871468 1:248051199-248051221 AAATTCACAGAGATGGAAAGTGG - Intronic
1062876404 10:946306-946328 AGTTTCCCACAGAAGGAAAGGGG - Intergenic
1062943587 10:1443254-1443276 ACATTCTCCCACATGAAATGGGG - Intronic
1063328166 10:5126346-5126368 ACATTTCTACAGATGAAAAGAGG + Intronic
1065158261 10:22893363-22893385 GCATTCCTGCTGATGAAAAGAGG - Intergenic
1066070269 10:31801433-31801455 ACATTCCCACCCATCAATAGAGG + Intergenic
1066282421 10:33930773-33930795 ACTTTCTAGCAGATGAAAAGAGG - Intergenic
1066482262 10:35808459-35808481 ACAATGGCAGAGATGAAAAGTGG - Intergenic
1066667665 10:37801780-37801802 GCAGTACCACAGATGAAAGGAGG + Intronic
1067513788 10:46919035-46919057 ACATTTCCAGAAATGAAAAGGGG - Intronic
1067648466 10:48132799-48132821 ACATTTCCAGAAATGAAAAGGGG + Intergenic
1068161653 10:53272288-53272310 ACATTCCTATAGATGAAAAGAGG + Intergenic
1068532848 10:58209053-58209075 ACATTCCTATAGATGAAAAGAGG - Intronic
1070291003 10:75113641-75113663 ACATACCCTCAGATGCACAGTGG + Intronic
1071001734 10:80838863-80838885 AAATGCCCACAGAAGAAAGGAGG - Intergenic
1071088146 10:81888130-81888152 ACAGTCCAGCAGATGCAAAGAGG + Intronic
1071302711 10:84268576-84268598 AGATTCCCACAAATGAAAAGTGG + Intergenic
1073651111 10:105359307-105359329 ACATGCTCACATATAAAAAGTGG + Intergenic
1074264905 10:111891892-111891914 ACATATCCATAGATGAGAAGAGG - Intergenic
1074407855 10:113195081-113195103 ACATTTTCACTGTTGAAAAGTGG + Intergenic
1075994660 10:126867551-126867573 ATATTCCCACAGAGTAAAGGGGG + Intergenic
1076325644 10:129619189-129619211 ACATTACAACAGATGCAAAAAGG - Intronic
1078914327 11:15764289-15764311 ACATTCTAAGAGATGAACAGTGG + Intergenic
1079123643 11:17702963-17702985 CCATTTCCACATATGAAAGGTGG - Intergenic
1080092328 11:28362879-28362901 ATATGCCCACAAATGAACAGAGG + Intergenic
1080978058 11:37365585-37365607 ACATTCCTGCAGATGAAAAGAGG + Intergenic
1082176502 11:49066191-49066213 ATATTCTCACAGATGTAAAGGGG + Intergenic
1082723439 11:56706580-56706602 GCATTCCTGCAGATGAAAAGAGG + Intergenic
1082944078 11:58739945-58739967 ACATTCCCACAAAAGACAGGAGG + Intergenic
1084040088 11:66537522-66537544 ACATTTTCAAAGATGGAAAGTGG - Intronic
1085851154 11:80121839-80121861 CCAGTCACACAGTTGAAAAGAGG + Intergenic
1085945037 11:81259350-81259372 ACATTCCCACACATAAACAATGG - Intergenic
1086266648 11:85006844-85006866 ACATGCCCACAGAGGAAAGCAGG - Intronic
1086689212 11:89769684-89769706 ATATTCTCACAGATGTAAAGGGG - Intergenic
1086716646 11:90070287-90070309 ATATTCTCACAGATGTAAAGGGG + Intergenic
1087364431 11:97201329-97201351 GCATTCCTCCAGATGAAAAAAGG - Intergenic
1087405371 11:97722997-97723019 ACATTCCTATAGATGAAAAGAGG + Intergenic
1087767880 11:102176215-102176237 ACATTCCCACTCATAAAAAATGG + Intronic
1090167906 11:124570845-124570867 ACATTCCCACGGCTGCAAGGTGG - Exonic
1093372620 12:18382973-18382995 ACATGTCCACAGATTAGAAGTGG - Intronic
1093460365 12:19402393-19402415 GCATTCCTGCAGATGAACAGAGG - Intergenic
1093533965 12:20201518-20201540 ACATTCCTACAGGTGAAAAGAGG - Intergenic
1093599202 12:21001547-21001569 ACATTCTTGCAGATGAGAAGAGG - Intergenic
1095777204 12:46023476-46023498 ACATTCATGCAGAAGAAAAGGGG - Intergenic
1095786241 12:46111164-46111186 GCATTCCTACAGATAAAAAGAGG + Intergenic
1097345638 12:58488948-58488970 CCATTCCCACTGATGAAATGTGG - Intergenic
1097737608 12:63199248-63199270 AAATGCCCACAGGAGAAAAGTGG + Intergenic
1097906993 12:64930916-64930938 ACATTTCTACAGATGAAAAGAGG - Intergenic
1098499738 12:71177632-71177654 ACATTCTTGCAGATGAAAAAAGG + Intronic
1099534264 12:83826131-83826153 GTATTCCTGCAGATGAAAAGAGG - Intergenic
1099567133 12:84265938-84265960 ACTTTCCCACATTTGGAAAGGGG - Intergenic
1099815128 12:87636008-87636030 AGATTACCAAAGATAAAAAGGGG + Intergenic
1100276876 12:93079704-93079726 AAATTCCCACAGACAGAAAGCGG + Intergenic
1100920995 12:99486794-99486816 ACATTCCTACAGATGAAAAGAGG - Intronic
1101536140 12:105618352-105618374 ACATTCACACATGTGAATAGTGG + Intergenic
1102048359 12:109844353-109844375 AAATTCCCACTGATGGACAGTGG - Intergenic
1103167357 12:118781787-118781809 AGATTCCCACAGCTGGTAAGTGG - Intergenic
1104083321 12:125452097-125452119 AAATGCCCACAGAAGAAAAGAGG + Intronic
1104569484 12:129912424-129912446 AGATTCCCACAGATGAATTCTGG + Intergenic
1104665380 12:130643770-130643792 ACATGCCCACAGAGCAACAGAGG + Intronic
1106124637 13:26890289-26890311 AAATTCCCAGAGTTGAAAAGAGG + Intergenic
1106513319 13:30430422-30430444 ACATTCCCTCAGACTAACAGGGG - Intergenic
1106778575 13:33032651-33032673 ACATGCCCACAGATTCAAGGGGG + Intronic
1109206137 13:59485347-59485369 ACATCCCGACAGGTGAAAAGTGG + Intergenic
1109484052 13:62996163-62996185 ACATTCTTGCAGATGAAAAGAGG - Intergenic
1109547479 13:63847216-63847238 ATATTCCTACAGATGATAAGAGG - Intergenic
1110019453 13:70451817-70451839 AGATTACCAAGGATGAAAAGAGG - Intergenic
1110020247 13:70460427-70460449 AAATGCCCACAGAAGAAAGGTGG + Intergenic
1110034919 13:70671728-70671750 AAATTCCCAAAGATGGCAAGTGG + Intergenic
1110355589 13:74562972-74562994 AAAGCCCCACATATGAAAAGAGG - Intergenic
1110803900 13:79733300-79733322 AGATTCCCACACATTAATAGTGG - Intergenic
1111164815 13:84445922-84445944 GCATTCCTGCAGATGAAAAGAGG - Intergenic
1112453630 13:99536591-99536613 ACAATCCTACACATGGAAAGAGG - Exonic
1112630747 13:101158881-101158903 ACACTCCCCCAGATGAAATAAGG - Intronic
1112729361 13:102342807-102342829 ACATTTCCATAGATAAAATGTGG + Intronic
1114133286 14:19818293-19818315 ACATTCCCACACAATAATAGTGG - Intronic
1114491843 14:23107365-23107387 ACATTTCTACAGATAAAAAGTGG - Intergenic
1115317308 14:32038441-32038463 ACATTCCAAAAGAATAAAAGGGG - Intergenic
1115796991 14:36949212-36949234 ACATTTCCAAAGATGAGAAGAGG - Intronic
1116274931 14:42820846-42820868 AAAATGCCACAGATGAAAAAAGG + Intergenic
1116334604 14:43640727-43640749 ACATTCCTACAGACAAAAACAGG + Intergenic
1118174928 14:63429263-63429285 ACAGTTTCACAGATGAAAGGGGG - Intronic
1118868824 14:69724911-69724933 ACACTCCAACATATGAACAGGGG - Intergenic
1119018183 14:71081972-71081994 AAATGCCCACAGAAAAAAAGTGG - Intronic
1119612346 14:76074349-76074371 ACATTTCCACAGATGAAAGCTGG + Intronic
1121159142 14:91718877-91718899 ACATTCCCAGAGGTTAAAAATGG - Intronic
1121740377 14:96247802-96247824 AAATTCCCACAGCTGGGAAGTGG - Intronic
1122185912 14:99995869-99995891 ACAGTACCACAGATGGAAATCGG - Intronic
1123576369 15:21674102-21674124 ACATTCCCACACAATAATAGTGG - Intergenic
1123612993 15:22116570-22116592 ACATTCCCACACAATAATAGTGG - Intergenic
1124414336 15:29462641-29462663 AAATTCCTCAAGATGAAAAGTGG + Intronic
1125692489 15:41607685-41607707 CCATTCCCACAGCTGAGGAGTGG - Intergenic
1126160038 15:45602721-45602743 ACATTCCCATAAAGGAAATGAGG - Intronic
1128505118 15:68263467-68263489 ACATTCATACATGTGAAAAGTGG - Intergenic
1128821415 15:70658512-70658534 CCAGTCCCACAGGTGAAAAATGG + Intronic
1129681244 15:77659679-77659701 ACCTTCCCACACAGGAACAGAGG + Intronic
1130605037 15:85307959-85307981 ACATTCCTGCAGATGAGTAGAGG + Intergenic
1130607161 15:85328351-85328373 AAATTTCCAAAGATGAAAATAGG - Intergenic
1131413807 15:92233587-92233609 ACATTCCTGCAGATTAAAAGAGG + Intergenic
1202985237 15_KI270727v1_random:408347-408369 ACATTCCCACACAATAATAGTGG - Intergenic
1134016024 16:10889051-10889073 TCATTGCCACGGATGAAGAGAGG + Intronic
1134320779 16:13160795-13160817 ACATGCCCACAGGAGAGAAGCGG + Intronic
1134863338 16:17581192-17581214 CCATTTCCACAGAAAAAAAGAGG - Intergenic
1136412373 16:30084922-30084944 ACATTCCCACAGCTGGAAGGCGG - Exonic
1138911887 16:61410916-61410938 GCATTCCAACAGAGGAAAACAGG - Intergenic
1140909547 16:79438876-79438898 ACGGTCCCAGGGATGAAAAGTGG - Intergenic
1143283225 17:5770516-5770538 ACAGTCCCACAGATGCACAGAGG + Intergenic
1143946870 17:10600900-10600922 ACATTCCAAAAGCTTAAAAGAGG - Intergenic
1144276394 17:13672505-13672527 ACATTCCTACAGATGAAAAGGGG + Intergenic
1146531914 17:33614864-33614886 ATAGTCCCACAGCTGGAAAGTGG - Intronic
1147321422 17:39648506-39648528 ACTTTCCCCCAGATAAACAGAGG + Intronic
1147757105 17:42775908-42775930 ACATTCCCAAGGAAGAGAAGAGG + Intronic
1149155545 17:53624905-53624927 ACATCCCCAGAGATGGCAAGAGG - Intergenic
1149442332 17:56685190-56685212 ACAGTCCCTCAGTTGAAAGGGGG - Intergenic
1151407312 17:73897067-73897089 GCATTTCCAGAGATGAACAGGGG - Intergenic
1152050623 17:77972803-77972825 ACATTTCCAGAAATTAAAAGAGG + Intergenic
1152071501 17:78136137-78136159 ACATTCCCACTGCTGATATGGGG - Intronic
1152436720 17:80280877-80280899 ACATTCCCACGGAGTAACAGAGG + Intronic
1153556226 18:6316678-6316700 ACATTCCTAGACATGAAAACAGG + Intronic
1153561301 18:6374466-6374488 ACAATCCCACAAAAGAAATGTGG - Intronic
1155638805 18:27987814-27987836 GCAATCCCACAGATTCAAAGTGG + Intronic
1155642727 18:28039035-28039057 ACAATCCCAGAGATGAGATGTGG - Intronic
1155893337 18:31293242-31293264 ATATTCCCCCATAAGAAAAGAGG + Intergenic
1157382135 18:47228082-47228104 AGATTCACTCAGATGAAAAGGGG - Intronic
1158278761 18:55797541-55797563 ACATTACCACAGATTAAAAAAGG - Intergenic
1160011774 18:75111429-75111451 ACATCCCCCCAGATCTAAAGGGG - Intergenic
1160058808 18:75510755-75510777 ACATTCCTATAGATGAAAAGAGG + Intergenic
1160299314 18:77665925-77665947 ACATTCAGACAGTTGAAAAATGG - Intergenic
1161929788 19:7331029-7331051 ACAGTCACAGAGCTGAAAAGTGG - Intergenic
1162084390 19:8239692-8239714 ACATTCCCATAAAGGAAACGTGG - Intronic
1163194294 19:15703843-15703865 GCATTCCTGCAAATGAAAAGAGG + Intergenic
1164422470 19:28106757-28106779 CCACTCCCACAGATATAAAGAGG + Intergenic
1167203994 19:48087501-48087523 ACATTCCTACAGATGAAAAGAGG + Intronic
924987416 2:284919-284941 ACATTCCAAAAGAAGAAAACAGG + Intronic
925637856 2:5959503-5959525 ACATTCCTTCAGATGAAAGATGG - Intergenic
925779414 2:7367841-7367863 ACATTCCCAGAGAGTAAAAGAGG + Intergenic
925796707 2:7553518-7553540 AAATTCCCTCAGAAGGAAAGTGG + Intergenic
926394040 2:12423389-12423411 ACAGACCCGCAGATGAACAGTGG + Intergenic
927459463 2:23285388-23285410 ACATGCACACACAGGAAAAGGGG + Intergenic
927837663 2:26413453-26413475 ACATTCCCACCCATGGAATGTGG + Intronic
928480087 2:31674874-31674896 ACATTTCTGCAGATGAAAATAGG - Intergenic
929064492 2:37960254-37960276 ACACTCCCACACATTAATAGTGG - Intronic
929101213 2:38316048-38316070 ACACTGCCACAGGAGAAAAGTGG + Intronic
931246240 2:60494992-60495014 ACAGCCCGACAGATGAAAAATGG + Intronic
932394073 2:71427268-71427290 ACCATCCCACAGATAAAAAAGGG + Exonic
933131967 2:78682827-78682849 ACATTCCTACAGATGAAAAGAGG + Intergenic
933340940 2:81025487-81025509 ATCTTCCTACAGATGAAAAGCGG - Intergenic
933349718 2:81137710-81137732 ATATTCCTGCAGATAAAAAGAGG + Intergenic
933814502 2:86054879-86054901 ACATTCCCAGAGATGAAGCAGGG + Intronic
935389849 2:102539611-102539633 ACATTTCCACTGAAGAAAATGGG + Intergenic
935926538 2:108075734-108075756 ACATTCCCACAGATAGTAAGTGG + Intergenic
936815479 2:116455821-116455843 ACATTCCTACAAATGAAAAGAGG - Intergenic
936819875 2:116507805-116507827 ACAGTCACACAGTTGAATAGGGG - Intergenic
936879344 2:117231722-117231744 ACATTCCTACAGATGAAAAGAGG - Intergenic
936885695 2:117308374-117308396 ACATTCCTGCAAATAAAAAGAGG - Intergenic
937461509 2:122092060-122092082 ACATTCCTACAGATGAAAAGAGG - Intergenic
938180660 2:129179223-129179245 CCAGTCCCACAGATCAAAATGGG - Intergenic
939305284 2:140402542-140402564 ACATTCCTACAGAGAAAAAGAGG + Intronic
940011572 2:149060262-149060284 ACTTGCCCACAGTTGGAAAGTGG - Intronic
940131359 2:150386915-150386937 GCATTCCTTCAGATGAAAAGAGG - Intergenic
940157322 2:150671642-150671664 ACAATCACACAAAGGAAAAGGGG - Intergenic
940466866 2:154041520-154041542 AAATTCACACACAAGAAAAGAGG + Intronic
941732952 2:168938581-168938603 ACATTTCTAGAGATGAATAGTGG + Intronic
941947967 2:171121125-171121147 AAATTTCTACAGATGAATAGTGG + Intronic
941967055 2:171310991-171311013 ATATACCCAGAGATGTAAAGGGG - Intergenic
942840782 2:180358909-180358931 ACATTCCTGCAGATAAAAAGAGG - Intergenic
943257385 2:185613093-185613115 ACATTACCACAAATGAAATAAGG - Intergenic
943446837 2:187996450-187996472 GCATTCCTGCAGCTGAAAAGAGG + Intergenic
944112179 2:196144588-196144610 ACATTTCCAGAAATGAAAAATGG + Intronic
944370312 2:198974509-198974531 ACATTCCTGCAGATGAAAAGAGG + Intergenic
944602951 2:201321674-201321696 AAATTCCTGCAGATGAAAAGAGG + Intronic
945608652 2:211970488-211970510 ACATTCCCACACAATAATAGTGG - Intronic
946222734 2:218242488-218242510 ACATACCCACACATGCAAACAGG - Intronic
946708270 2:222480702-222480724 ACTCTCACACAGATGATAAGCGG - Intronic
947033019 2:225819697-225819719 CCATTACCACAGCTGATAAGTGG + Intergenic
948072864 2:235141407-235141429 ACATGCCCAGAGATTGAAAGGGG + Intergenic
948480495 2:238247247-238247269 ACTTCCCCAGAGAGGAAAAGAGG - Intronic
1168866486 20:1091161-1091183 GCCTTCCCACAGATGAGAACAGG + Intergenic
1170906228 20:20517227-20517249 TCATCCCTACAGATGAAAAGAGG + Intronic
1174273253 20:49384782-49384804 ACAGTCACAAAGATGGAAAGAGG + Intronic
1174435340 20:50502518-50502540 ACAGTCACACAGATGAGAAATGG - Intergenic
1175049933 20:56145826-56145848 AAATTCACACAGAAGAAAACAGG + Intergenic
1175580336 20:60093988-60094010 AAATTCCCACTGATGTAAAGTGG + Intergenic
1175618066 20:60420388-60420410 GCATTCCTGCAGATGAAAAGAGG - Intergenic
1176337054 21:5609016-5609038 TCATGCCCACAGATGAAAGGTGG - Intergenic
1176390703 21:6211932-6211954 TCATGCCCACAGATGAAAGGTGG + Intergenic
1176470716 21:7104242-7104264 TCATGCCCACAGATGAAAGGTGG - Intergenic
1176494277 21:7486020-7486042 TCATGCCCACAGATGAAAGGTGG - Intergenic
1176506365 21:7652363-7652385 TCATGCCCACAGATGAAAGGTGG + Intergenic
1177367362 21:20155033-20155055 ACATTCCTGAAGATGAAAAGAGG + Intergenic
1177796494 21:25784181-25784203 ACATCCTCACAGATGAAGTGAGG - Intergenic
1177950847 21:27535192-27535214 TCATTCCGACAGATGAAAAGAGG + Intergenic
1179222554 21:39421694-39421716 ACTTTCCCAAACAGGAAAAGTGG + Intronic
1180650550 22:17372833-17372855 TCTTTCCCACAGCTGAAAACTGG - Intronic
1181077431 22:20390648-20390670 ACAGCCCCACAAATGAAAAGAGG + Intronic
1181946568 22:26522239-26522261 ACAGTCGCACAGTTGGAAAGTGG + Intergenic
1182586718 22:31347506-31347528 AAGTTCCCACAGTTGCAAAGAGG + Intergenic
1182877608 22:33705984-33706006 AGAGTCCCACAGATGATAAATGG + Intronic
1183143319 22:35965383-35965405 AGATTTCCACAGAGTAAAAGGGG + Intronic
1183262937 22:36807664-36807686 CCATTCCCACACCTGGAAAGTGG - Intronic
1183300611 22:37057286-37057308 ACATACCCAAAGAAGAAGAGAGG - Intronic
1184287077 22:43477806-43477828 AAAGTCACACAGCTGAAAAGTGG - Intronic
1184472785 22:44705058-44705080 ACAGTCACACAGATAAAAGGGGG - Intronic
949113904 3:296540-296562 TCATGACCACAGAGGAAAAGAGG + Intronic
949279606 3:2330566-2330588 ACAATATCACAGAGGAAAAGAGG + Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
950328484 3:12136438-12136460 AAAGTCACACAGCTGAAAAGTGG + Intronic
952027262 3:29098721-29098743 ACATCCCTACAGAAGAAAAGAGG - Intergenic
952275750 3:31874665-31874687 TCATTCTCACAGATCAAAATTGG - Intronic
952469805 3:33635455-33635477 ACATTCCTGCAGAAGAAAAGAGG + Intronic
952993756 3:38856399-38856421 ACATTCCTACAGATGAAAAGAGG + Intronic
953962096 3:47274074-47274096 ACTTCCCCACAGAGGCAAAGAGG + Intronic
955302960 3:57800785-57800807 TTATTCTCACAGATGAAAATAGG + Intronic
955335265 3:58080296-58080318 ACACTTCCTCAGATGAACAGAGG - Intronic
956912138 3:73829035-73829057 AAAATCCCACAGCTGAAAATAGG - Intergenic
957087025 3:75690320-75690342 CAATTCACACAGATGAAAAATGG + Intergenic
957203818 3:77168893-77168915 ACAATCCCACAGATGAGAGAGGG - Intronic
957766084 3:84625795-84625817 ACATCCCTACAGAAGAAAGGTGG - Intergenic
957777064 3:84767168-84767190 ACATTCCTATAGATAAAAAGAGG + Intergenic
957801585 3:85090885-85090907 ATTTTTCCACAGATGGAAAGGGG - Intronic
958171903 3:89948703-89948725 ACATTCCTGGAGATGGAAAGAGG + Intergenic
958530864 3:95329011-95329033 ACATTTCTGCAGATGAAAAGAGG - Intergenic
958768383 3:98397310-98397332 GCATCCTTACAGATGAAAAGAGG + Intergenic
959015364 3:101128104-101128126 ACATTCCAACTCATTAAAAGTGG + Intergenic
959321418 3:104880126-104880148 ACATTCACACAAAAGAAAAATGG + Intergenic
959750299 3:109826936-109826958 AAATTCCCAGAGATGAGGAGAGG + Intergenic
959781291 3:110236786-110236808 ACAATTCAACAGATGAAATGCGG - Intergenic
960193952 3:114742151-114742173 ACATTACCCCATATGACAAGTGG + Intronic
960578105 3:119246718-119246740 ACATTCCTGTAGATGAAAAGAGG + Intergenic
960712303 3:120544010-120544032 ACCTACCTACAGATGAAAAGAGG - Intergenic
960782185 3:121331490-121331512 AAATTCCTGCAGATGAAAAGAGG + Intronic
963406536 3:144870680-144870702 TCATTCCCACATATTAAAAAAGG + Intergenic
963507046 3:146199383-146199405 ACCTTGCCACAGATAAAGAGTGG - Intronic
963907826 3:150787838-150787860 ACATTACCACAGTAGAAAATGGG - Intergenic
964200568 3:154114453-154114475 TCATTCCCACAGTTCAAAAGTGG + Intergenic
964332841 3:155622792-155622814 ACACTCCCACAGAATAACAGTGG + Intronic
964564222 3:158032203-158032225 ACATTCCTGCAGAGGAAAAGAGG + Intergenic
964564389 3:158033844-158033866 ACATTCCTGCAGATGAAAAGAGG + Intergenic
964635851 3:158858253-158858275 ACATTACCACAAATGAAAAGAGG - Intergenic
965618436 3:170618755-170618777 ACATTCCCACAGGAGAAAGCAGG - Intronic
967151292 3:186653117-186653139 ACTTCCAGACAGATGAAAAGAGG - Intronic
967246557 3:187492361-187492383 ACATTCCTATAGATTAAAAGAGG + Intergenic
967434892 3:189432066-189432088 GCATTCCTGCAGATGAAAAGAGG + Intergenic
968081954 3:195852704-195852726 ACATTCCAGCAGGTGACAAGGGG + Intergenic
970687794 4:18588186-18588208 GAATTCCCACAGATGTTAAGTGG - Intergenic
971125932 4:23754418-23754440 ACATACACACACATGAAAAAGGG - Intergenic
971340951 4:25768391-25768413 ATCTTTCAACAGATGAAAAGTGG - Intronic
971623193 4:28883392-28883414 ACATCACCACAGAAGAAATGGGG - Intergenic
971721183 4:30246996-30247018 ACAATCCTACAGATGAAAAGAGG - Intergenic
972025765 4:34374752-34374774 ACATTCCCTTATTTGAAAAGGGG - Intergenic
972487767 4:39558620-39558642 ACAATCCCACAGCTGGAAAAAGG + Intronic
973323485 4:48833416-48833438 ACATTCCAACAGAGGAAGAAAGG + Exonic
974534254 4:63154292-63154314 ACATTTCTATAGAAGAAAAGAGG - Intergenic
975799438 4:78044322-78044344 TCATTCCAAGATATGAAAAGAGG - Intergenic
976743649 4:88382306-88382328 ATATGCCCACAAATGAAAACCGG - Intronic
977126004 4:93169002-93169024 ATATTCCCTCAGATGACTAGGGG + Intronic
977510081 4:97952079-97952101 ACATTCCTGAAGATGAAAATAGG - Intronic
977624838 4:99179176-99179198 ATATTCCTGCAGATGAAAGGAGG - Intergenic
977654311 4:99504093-99504115 GCATTCCTGCAAATGAAAAGAGG - Intergenic
977729580 4:100334601-100334623 ACATTCCCACACAATAATAGTGG + Intergenic
979195444 4:117915728-117915750 ACATTCCTACAGATGAAAAGAGG - Intergenic
979424374 4:120547626-120547648 GCATTCCCATGGATGGAAAGAGG + Intergenic
979434762 4:120674721-120674743 ACATTCCTACAGATGAAAAGAGG + Intergenic
980871755 4:138619833-138619855 AAATTACCAGACATGAAAAGAGG + Intergenic
980992778 4:139752460-139752482 ACAACCCCACCTATGAAAAGGGG + Intronic
981177712 4:141701856-141701878 ACATTCCTACACATGAAAAGAGG - Intronic
981703140 4:147628988-147629010 GCATGCTCACAGAGGAAAAGTGG + Intronic
981923736 4:150116080-150116102 ACATGCCTGCAGATGAAAAGAGG - Intronic
982187797 4:152820008-152820030 GCATTCCTGCAGATGAAAAGAGG + Intronic
982640876 4:157958926-157958948 ACATTTGCAAAGATTAAAAGTGG + Intergenic
984020173 4:174475595-174475617 GCCTTCCTGCAGATGAAAAGAGG + Intergenic
984187434 4:176563028-176563050 AAATTCTCAAAGATGGAAAGTGG + Intergenic
986826574 5:11528850-11528872 ACCTGGCCACTGATGAAAAGGGG - Intronic
986845236 5:11744608-11744630 ACACTGCCAGAGAAGAAAAGTGG + Intronic
986969137 5:13311556-13311578 ACACTCCCACAGATGTAACCTGG + Intergenic
987916882 5:24226845-24226867 GCATTCCTGCAGATGAAAAGAGG - Intergenic
988800653 5:34693335-34693357 ACAGTCCCAAGGATGAACAGTGG - Intronic
988823726 5:34914275-34914297 ACAGTCCCACAGCTGGTAAGTGG - Intronic
989155147 5:38337848-38337870 ATTTTCCCACAGCTGAACAGAGG - Intronic
989818387 5:45764561-45764583 ACATTCCTGCAAATGAAAAGAGG - Intergenic
990005541 5:50940041-50940063 ATATTCCTACAGATGAAAAGAGG + Intergenic
991137065 5:63194214-63194236 ACATTCCTGCAGATGAAAAGAGG + Intergenic
992870619 5:81001746-81001768 ACAATCCCACAGCAGAACAGAGG - Intronic
993171871 5:84430190-84430212 GCATTCCTGCAGATAAAAAGAGG - Intergenic
993253598 5:85558563-85558585 AGACTCCCACATATTAAAAGTGG + Intergenic
993796705 5:92276040-92276062 ACGTTTCTACAGATGAAAAGAGG + Intergenic
994496407 5:100518302-100518324 GCATTCCTGCAGATGAAAAGAGG + Intergenic
994605102 5:101956862-101956884 ACATTTCCACACTGGAAAAGTGG + Intergenic
995115454 5:108473100-108473122 GCATTCCTACAGATGTAGAGAGG + Intergenic
995187031 5:109282120-109282142 ACATTTCTGCATATGAAAAGAGG + Intergenic
996413648 5:123186150-123186172 ACACACCCACAGATGAACTGTGG - Intronic
997891126 5:137677874-137677896 ACATCAACACAGATGAAAATGGG + Intronic
998351055 5:141501642-141501664 ATTTTCCAACAGATGAAAACAGG - Intronic
998531773 5:142891657-142891679 ACATTCCTACAGAAGAAACTTGG - Intronic
998703224 5:144729799-144729821 ACGTTCCTATAGATGAAAATAGG + Intergenic
998703348 5:144731116-144731138 ACATTCCTGTAGATGAAAAGAGG - Intergenic
998860939 5:146443406-146443428 ACATTCAGATAGCTGAAAAGAGG - Intergenic
999135330 5:149315043-149315065 ACATTCCCACAGCTAATAAGTGG + Intronic
999930766 5:156431212-156431234 ACATTTCTACAGATGAAAAGAGG - Intronic
1001626431 5:173139576-173139598 ACTTGCCCAAAGATTAAAAGAGG - Intergenic
1002016700 5:176329820-176329842 AGATTTACACATATGAAAAGGGG + Intronic
1002650546 5:180689567-180689589 AAATACCCACAGATGTGAAGAGG - Intergenic
1003093473 6:3123618-3123640 ACATCCCCACAGGGGGAAAGGGG - Intronic
1004139834 6:13007705-13007727 ACATTACCACTGATGAGAAGAGG - Intronic
1005395349 6:25377004-25377026 ACATTCCTGCAGATGAAAAGAGG - Intronic
1005665541 6:28049882-28049904 AAATTACAACACATGAAAAGAGG + Intergenic
1007269339 6:40624289-40624311 ACCTTCCCACATAAGAAAAAAGG + Intergenic
1008185749 6:48388586-48388608 ACATTTCTAAGGATGAAAAGAGG - Intergenic
1009614871 6:65991094-65991116 GCATTCCTGCAGCTGAAAAGAGG + Intergenic
1009624734 6:66125534-66125556 GCATTCCTGCAGATAAAAAGGGG - Intergenic
1010260518 6:73810468-73810490 CAGTTACCACAGATGAAAAGTGG - Intronic
1010495494 6:76530136-76530158 AGATTCCCACAGAATAATAGTGG - Intergenic
1011394626 6:86892815-86892837 ACATTCCTACAGACAAAAAGAGG + Intergenic
1012079507 6:94737253-94737275 ACATTCCTACAGATGAGAAGAGG + Intergenic
1012134442 6:95538578-95538600 ACATTCCCACACAATAATAGTGG - Intergenic
1012191798 6:96288390-96288412 ATATTCCTGCATATGAAAAGTGG + Intergenic
1012203393 6:96434313-96434335 ACATTCCTACAGAATAAAAGAGG - Intergenic
1012632446 6:101488635-101488657 ACAAGCCCAGAGAGGAAAAGTGG - Intronic
1012696625 6:102391987-102392009 ACATTCTGACAGATTAAAAGAGG + Intergenic
1012709903 6:102585735-102585757 ACAATATCACAGATGACAAGAGG - Intergenic
1013694427 6:112685314-112685336 ACCTTCCCACTGATCAAAATTGG + Intergenic
1014421056 6:121245803-121245825 ACATTCCCACAGATGAAAAGAGG + Intronic
1014532059 6:122570150-122570172 ACATTCTTACAGATGAAAAGAGG + Intronic
1014658236 6:124133282-124133304 ACAGTCCTATAGATGAAAAGAGG + Intronic
1014749914 6:125244534-125244556 ACATTTCCATAGATGAAAAGAGG - Intronic
1015250138 6:131118796-131118818 ACATTTCCACAGAGAAAATGAGG + Intergenic
1015751432 6:136563721-136563743 ACATTCCAAGTTATGAAAAGAGG + Intronic
1016031726 6:139344789-139344811 ACATTCCTGCAGATGAAAAGAGG + Intergenic
1016498217 6:144689090-144689112 GCATTCCTACAGATGGAAAGAGG - Intronic
1017375274 6:153761171-153761193 ACATTCCCACAGATGAAAAGAGG + Intergenic
1018674158 6:166204832-166204854 AAATTCCCCCAAATGAAGAGGGG + Intergenic
1020997497 7:15281468-15281490 ACATTCCTGTAGATGAAAAGAGG + Intronic
1021754810 7:23841950-23841972 ACATTCCTATACATAAAAAGAGG - Intergenic
1021769628 7:23985327-23985349 GCATTCCTACAGATAAAAAGAGG + Intergenic
1023445240 7:40224793-40224815 ACATCCATACAGATGAAAAGAGG - Intronic
1026580006 7:71607742-71607764 AAAACCCCACAGATTAAAAGAGG + Intronic
1027838542 7:83278326-83278348 ACATTCCTGCAGATTAAAAGAGG - Intergenic
1028863366 7:95679822-95679844 ACATTGCACCAGAAGAAAAGAGG - Intergenic
1030095965 7:105900159-105900181 GCCTTCCTGCAGATGAAAAGAGG + Intronic
1030150088 7:106395682-106395704 ACAGTCACACAGCTGGAAAGTGG + Intergenic
1030643510 7:112032919-112032941 ACATTCCTAAAGGGGAAAAGAGG + Intronic
1030808571 7:113946434-113946456 GCATTCCTGCAGATGAAAAGAGG + Intronic
1030829752 7:114206640-114206662 TCATTCCAACAGAGGAAGAGAGG - Intronic
1036499805 8:9303282-9303304 ACATTCCATCAGATGAAACTGGG - Intergenic
1037092752 8:14943517-14943539 CCATTCTCATAGATGGAAAGAGG - Intronic
1039112187 8:34052250-34052272 ATATCCCTACAGATGAAAGGAGG + Intergenic
1039198462 8:35059804-35059826 GCATTTCCGCAGATGAAAAGAGG - Intergenic
1040124596 8:43722884-43722906 AAATATCCTCAGATGAAAAGTGG + Intergenic
1040292216 8:46131311-46131333 AGACTCCCACAAATGAAAACGGG - Intergenic
1040305114 8:46208052-46208074 AGACTCCCACAGGTGAAAACGGG + Intergenic
1040362715 8:46683103-46683125 ACATTCCTAGAGATGAAACATGG - Intergenic
1040618220 8:49061491-49061513 AAATGCCCACAGATGGAAATTGG + Intronic
1041426458 8:57726239-57726261 AACTTACAACAGATGAAAAGAGG - Intergenic
1042084268 8:65090064-65090086 ACATTCCTATAGATGAAAAGAGG + Intergenic
1043646575 8:82528249-82528271 ACATTACCAGAGATGAATAGGGG + Intergenic
1044374259 8:91450812-91450834 AAATTTCCACAGATGAAATTGGG + Intergenic
1045229824 8:100293220-100293242 ACATGACACCAGATGAAAAGTGG - Intronic
1045517021 8:102868630-102868652 ACATTCCCTCAGACAAGAAGAGG - Intronic
1046077340 8:109328859-109328881 AGATTACCACATATGCAAAGAGG + Intronic
1046993990 8:120495033-120495055 ACATTCTGAAAGAAGAAAAGAGG - Intronic
1047022226 8:120786630-120786652 GCATTCCTACAGATGAAAAGAGG + Intronic
1048806205 8:138243480-138243502 GCTTTTCCACAGAAGAAAAGAGG - Intronic
1049594935 8:143478975-143478997 ACATTCCCAAGCATGAAGAGCGG - Intronic
1049732833 8:144187521-144187543 ACATTCCCACAAATTATTAGAGG + Intronic
1050212586 9:3279276-3279298 ACAATTCCATAGCTGAAAAGGGG - Intronic
1050476292 9:6044914-6044936 ACATTCCTGCAAATGAAAAGAGG - Intergenic
1052092738 9:24349042-24349064 ATATTCCTTCAGATGAAAGGAGG + Intergenic
1052957281 9:34263161-34263183 ACATTCCTTCAGCTGCAAAGTGG + Exonic
1053024667 9:34719829-34719851 GCATTCCCAAAGATCAAAGGAGG - Intergenic
1053031796 9:34786642-34786664 ACATTTCCACATATAAATAGAGG + Intergenic
1053106854 9:35416787-35416809 ACATTCCTGCAGATGAAAAGAGG + Intergenic
1054784618 9:69199125-69199147 ACCTACCTCCAGATGAAAAGAGG - Intronic
1055577694 9:77676763-77676785 GCATTCCAAGAGAAGAAAAGTGG + Intergenic
1056452002 9:86725385-86725407 ACATTCTCACATATAAAAAGTGG + Intergenic
1057286239 9:93756888-93756910 ACGTTTCTGCAGATGAAAAGAGG - Intergenic
1057597134 9:96424087-96424109 ACCTTTCCACAGATGGAGAGAGG - Intergenic
1058272246 9:102986696-102986718 ACACTTCTATAGATGAAAAGAGG + Intergenic
1058274477 9:103023263-103023285 ACTATCCCACAGATTATAAGGGG + Intergenic
1058343057 9:103921302-103921324 ACTTTCTGATAGATGAAAAGAGG + Intergenic
1059764114 9:117367109-117367131 ACATTCTCACAGCAGAATAGAGG + Intronic
1059790300 9:117635425-117635447 CCATTTCCCCAGATGAAATGTGG + Intergenic
1061816108 9:133197659-133197681 AAATTCACACAGAAAAAAAGTGG - Intergenic
1203424598 Un_GL000195v1:25890-25912 TCATGCCCACAGATGAAAGGTGG + Intergenic
1186180129 X:6965715-6965737 ATAATCCCACAAATGAAGAGAGG - Intergenic
1186676472 X:11822574-11822596 TCATTCCCAGAGTGGAAAAGAGG - Intergenic
1186702415 X:12106213-12106235 ACATTCTCACTGTTCAAAAGGGG - Intergenic
1187411971 X:19059296-19059318 AAATTCACACAGCTGGAAAGTGG - Intronic
1188094364 X:26003464-26003486 ACATTCCTTCAGATGAAAAGAGG + Intergenic
1188790491 X:34403516-34403538 ACTTTTCTACAGATGAAAAATGG - Intergenic
1188886944 X:35562340-35562362 ACTTTCCTACAGATGAAAAGAGG - Intergenic
1188956220 X:36437279-36437301 CCATTCCTGGAGATGAAAAGAGG + Intergenic
1189496052 X:41509737-41509759 ACATTCCAACAAATGAACAAAGG - Intergenic
1191111775 X:56809367-56809389 ACATTCCCACACAAAAACAGTGG - Intergenic
1191146973 X:57177316-57177338 GCATTCCTGCATATGAAAAGAGG - Intergenic
1192727137 X:73765390-73765412 GCATTCCTGCAGATTAAAAGAGG - Intergenic
1193059263 X:77187477-77187499 ACATGCCCACAAAAGAAAACAGG + Intergenic
1193265611 X:79464635-79464657 ACATTCCTACAGATGAAAAGTGG + Intergenic
1193460858 X:81789769-81789791 ACATTTCTACAGATGAAAATAGG - Intergenic
1193549277 X:82870982-82871004 ACATTCCTATAGATGAAAAGAGG - Intergenic
1193587079 X:83337377-83337399 ACATACCCACAAATAAAGAGAGG + Intergenic
1193994362 X:88346063-88346085 ATATTCCTTCAGATGAAAACAGG + Intergenic
1194090049 X:89574751-89574773 ACATTCCTATAGATAAAAAGGGG - Intergenic
1194337616 X:92666729-92666751 ACATTCTTGCAGATGTAAAGAGG + Intergenic
1194556757 X:95369168-95369190 ACATCTCTACAGATAAAAAGAGG + Intergenic
1194589546 X:95781999-95782021 ACATCCCCACAGAAGAGAAAGGG + Intergenic
1194616426 X:96109571-96109593 ACAGTTTCACAGATGAAGAGAGG - Intergenic
1194623274 X:96198689-96198711 ATATTCCTACAGATGAAAAGAGG + Intergenic
1194634146 X:96323141-96323163 ATATTTCTACAGATGTAAAGAGG - Intergenic
1195686986 X:107596441-107596463 ATATTCTCACAGATAAAATGGGG + Intronic
1195812897 X:108853668-108853690 AGATTCCCACAGAACAATAGTGG + Intergenic
1197049892 X:122045579-122045601 ACATTCATGTAGATGAAAAGAGG - Intergenic
1197371286 X:125628693-125628715 GCATTCCTGCAAATGAAAAGAGG + Intergenic
1197603880 X:128561661-128561683 ACATTTCTATAGATGAAAAGAGG + Intergenic
1197971613 X:132120581-132120603 CCATCCCCACAGCTGAAAGGAGG - Intronic
1198596078 X:138237194-138237216 ACATTCCAACAGGTGTAAAATGG - Intergenic
1198836801 X:140814753-140814775 ATATTCCTGCAGATGAAAAGAGG - Intergenic
1198848807 X:140943008-140943030 TCTTTCCTACAGAAGAAAAGGGG + Intergenic
1199077192 X:143537191-143537213 ACATTTCTACAGATGAAAAGAGG + Intergenic
1199088047 X:143651841-143651863 TCATTGCCACAAATGAAAACAGG + Intergenic
1199241782 X:145555234-145555256 ACATTCTTACAAATGAAAAGAGG + Intergenic
1199332666 X:146580954-146580976 ACATTCCTGCAGATAAAAGGAGG - Intergenic
1200054494 X:153452203-153452225 ACATTCCCACATAAAAAATGAGG + Intronic
1200442697 Y:3230805-3230827 ACATTCCTATAGATAAAAAGGGG - Intergenic
1200528212 Y:4298564-4298586 ACATTTCCATAGACAAAAAGTGG + Intergenic
1201391613 Y:13503309-13503331 ACATCCCTACAAATAAAAAGAGG + Intergenic
1201862627 Y:18615951-18615973 ATCTCACCACAGATGAAAAGGGG - Intergenic
1201870696 Y:18704429-18704451 ATCTCACCACAGATGAAAAGGGG + Intergenic