ID: 1014425394

View in Genome Browser
Species Human (GRCh38)
Location 6:121298660-121298682
Sequence ATTGAGCAGCAGAAGAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 338}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014425394 Original CRISPR ATTGAGCAGCAGAAGAAGAG AGG (reversed) Intronic
900462522 1:2808535-2808557 CTTGTGCAGCAGAAAAGGAGAGG - Intergenic
901025017 1:6274563-6274585 ATAGGGCAGCAGCAGAAGCGAGG + Intronic
901500716 1:9651377-9651399 TGAGAGCAGGAGAAGAAGAGGGG - Intergenic
902187813 1:14738611-14738633 AATGAGCTTCAGGAGAAGAGAGG + Intronic
902228273 1:15010744-15010766 ATTCAGCAGAAGTAGCAGAGTGG + Intronic
903142758 1:21349150-21349172 TTTGAGCAGCATAAGACCAGGGG - Intergenic
903605086 1:24569534-24569556 ATTGAGCGGCAGCAGTAAAGTGG + Intronic
903651768 1:24926939-24926961 CTTGAGCAGCAGAAGGAAGGCGG - Intronic
903801916 1:25975221-25975243 ATTGAGATGGAGAAGAATAGAGG - Intronic
904396619 1:30226718-30226740 AGTGTGTAGCAGAAGACGAGAGG - Intergenic
909292181 1:73897606-73897628 ATTGCGTAGAGGAAGAAGAGAGG + Intergenic
909344887 1:74573169-74573191 AGGGAGCAGCAGAAGCAGAAGGG - Exonic
910092023 1:83476549-83476571 ATTGCACAGCAGAGGAAGAGGGG - Intergenic
910803591 1:91168224-91168246 TTGGAGAAGCTGAAGAAGAGAGG + Intergenic
912487850 1:110043232-110043254 ATTGAGCAGCAGCAGAAACGGGG + Exonic
912800514 1:112716987-112717009 ATAGAGCAGCAAAAGAAGACGGG + Intergenic
914216072 1:145629753-145629775 ATGGAGAAGCAGAAGACCAGAGG + Intronic
914468641 1:147952406-147952428 ATGGAGAAGCAGAAGACCAGAGG + Intronic
915193233 1:154169434-154169456 TTTCAGAAGCAGATGAAGAGAGG + Intronic
916709987 1:167396252-167396274 ACAGAGCAGGAGAAGAGGAGAGG - Intronic
917088037 1:171323324-171323346 CTTGAGCAGCAGCGGAAGTGAGG - Intronic
919154928 1:193751812-193751834 ATTCAGCTGCAGAAGAGTAGTGG + Intergenic
920032303 1:203044730-203044752 ATGGAGCGGCAGAAGAGGAGGGG + Intronic
920131252 1:203733751-203733773 AAGGAGCAGGAGGAGAAGAGAGG - Intronic
921591333 1:217007746-217007768 AATAAGCATCAGAAGAAAAGAGG - Intronic
922750361 1:228067384-228067406 TTTGGGCAGCAGAAGAAGACAGG - Intergenic
923378296 1:233388914-233388936 TGGGAGTAGCAGAAGAAGAGAGG - Intergenic
923791443 1:237114796-237114818 ATTAAGCAGCAGGATCAGAGAGG - Intronic
924067160 1:240235829-240235851 ATGGGGCAGAGGAAGAAGAGGGG - Intronic
924146678 1:241083479-241083501 ATCGAGCTGCGGAACAAGAGGGG - Intronic
924351267 1:243116619-243116641 ATTAAGCAGAACAGGAAGAGAGG + Intergenic
924383795 1:243485058-243485080 AAGAAGAAGCAGAAGAAGAGAGG + Intronic
924840396 1:247704753-247704775 GGTGAGTAGCAGAAGTAGAGAGG + Intergenic
1063052698 10:2470284-2470306 ATTGCACAGCAGCAGCAGAGTGG - Intergenic
1063358543 10:5427419-5427441 ATGGAGAAGGAGAAGAAGTGGGG - Intronic
1064076222 10:12270926-12270948 CTTAAGAAGCAGAAGTAGAGAGG - Intergenic
1064576660 10:16752729-16752751 ATTGAGCTTTAGTAGAAGAGAGG - Intronic
1064673893 10:17742394-17742416 ATTGAGGAGGACAAGGAGAGAGG + Intergenic
1064774766 10:18764205-18764227 GATGAGGAGCAGAAAAAGAGAGG + Intergenic
1065241346 10:23708346-23708368 ATTGAACAGCAGCAGAAGGAGGG + Intronic
1065248601 10:23786136-23786158 ATTGAGCAACAGAGGTACAGGGG + Intronic
1066342331 10:34547998-34548020 CTTGATCAGTAGAAGATGAGTGG - Intronic
1068257344 10:54530267-54530289 ATTAACCAGGGGAAGAAGAGTGG - Intronic
1068729183 10:60337261-60337283 CTTGAGCAGTGGAAGAGGAGAGG - Intronic
1069666197 10:70161659-70161681 TTTGAGCATGTGAAGAAGAGTGG + Exonic
1069675698 10:70245670-70245692 AATGTCCAACAGAAGAAGAGTGG - Intergenic
1070157416 10:73843977-73843999 TTTGGACAGCAGAAAAAGAGAGG - Intronic
1071097583 10:81996658-81996680 ACTGAGAGGGAGAAGAAGAGGGG + Intronic
1072439956 10:95445588-95445610 CTTGACCAGCAGAAGATGGGAGG + Intronic
1073578591 10:104644031-104644053 GTTGTGCAGCAGAAGAGGTGAGG + Intronic
1073819354 10:107242975-107242997 ATTGAGCAGCTGAGGAGGAAAGG - Intergenic
1074928304 10:118096286-118096308 ATGGAACAGCAGAAAAAGTGAGG - Intergenic
1075292198 10:121240307-121240329 AATGAGCTGCAGAATAAGAGGGG - Intergenic
1075581953 10:123625598-123625620 ACTCAGCCCCAGAAGAAGAGTGG + Intergenic
1076491079 10:130862109-130862131 ATAGAGCAACAGGAGAGGAGGGG - Intergenic
1079564402 11:21864585-21864607 TTGGAATAGCAGAAGAAGAGAGG - Intergenic
1080062075 11:27967542-27967564 TTTGAGGAGAAGAAGAAAAGAGG + Intergenic
1080140853 11:28918286-28918308 ATTGTGTAGCAGAAGAAGTTTGG + Intergenic
1080431651 11:32205102-32205124 ATTGACCATCACAAGCAGAGAGG + Intergenic
1080955397 11:37088144-37088166 AATTTGCAGCAGAAGAATAGAGG + Intergenic
1081431247 11:42978909-42978931 ATAGAACAGCAGAGGAAGATGGG + Intergenic
1081845256 11:46236990-46237012 ATTGAGTAGAAGAGGAAGGGCGG + Intergenic
1083904630 11:65662031-65662053 ATTGAGCAGCCCAAGCAGCGGGG - Exonic
1086035312 11:82407681-82407703 AATGAGAAGCAGAAAAAGTGGGG - Intergenic
1086539427 11:87890390-87890412 CTTAAGCAGCAGAAGAACATAGG - Intergenic
1086867975 11:92003252-92003274 AGAGAGAAGCAGAAGCAGAGAGG + Intergenic
1087091162 11:94274569-94274591 CTCCAGCAGCAGAAGGAGAGAGG - Intergenic
1088848758 11:113688902-113688924 ATTGAACAGATGAAGGAGAGTGG + Intronic
1089175853 11:116548300-116548322 ATGGAGCAGCTGAGGGAGAGTGG - Intergenic
1089344404 11:117781590-117781612 AATGAGGACCAGCAGAAGAGTGG + Intronic
1089690579 11:120184551-120184573 AATGAGCAGCAGAGGAGGAAAGG - Intronic
1090160022 11:124482744-124482766 GTGGAGAAGCAGAAGCAGAGGGG - Intergenic
1090509770 11:127362913-127362935 GTGGAGCAGCAGAGGAGGAGAGG - Intergenic
1090643973 11:128752443-128752465 AATGAGCAGCAGATGAAGCTTGG + Intronic
1092238264 12:6822812-6822834 TTTGAGCAGAAGAGAAAGAGGGG - Intronic
1093228860 12:16518226-16518248 AGTTAGCAGCACAGGAAGAGAGG - Intronic
1093391195 12:18624916-18624938 ACTAAGCAGGAGAAAAAGAGAGG - Intronic
1095578536 12:43767418-43767440 ATGGAGTAGCAGAAGTAAAGGGG + Intronic
1096671203 12:53199228-53199250 ATGGAGCAGCAGAGCAGGAGGGG - Intronic
1097437421 12:59568346-59568368 ACTGAGAAGCAGAATGAGAGGGG + Intergenic
1098938202 12:76504513-76504535 TTTCACCATCAGAAGAAGAGTGG - Intronic
1099286886 12:80724009-80724031 ATTGACCAGGTGAAGTAGAGGGG - Intergenic
1100891585 12:99131985-99132007 GGGGAGGAGCAGAAGAAGAGAGG - Intronic
1101766822 12:107708666-107708688 CTAGAGCAGTAGAAGAAAAGAGG - Intronic
1102577366 12:113864354-113864376 CTTGAGCATCTGAGGAAGAGGGG - Intronic
1102737023 12:115171180-115171202 TTTAAGCAGCAGCAGAAGACAGG + Intergenic
1103509039 12:121461617-121461639 CTTGAGCAACAGAAGAACAAGGG + Intronic
1103523184 12:121549751-121549773 ATTGAACAGATGAGGAAGAGGGG - Intronic
1104188865 12:126458632-126458654 ATTAAGGAGCAGAAGCAGTGTGG - Intergenic
1104424079 12:128660285-128660307 TTTGAGCACCAGAATCAGAGAGG - Intronic
1104793783 12:131501607-131501629 ATCGAGCAGCACAAGATCAGGGG + Intergenic
1106716230 13:32391308-32391330 ATTGGGCAGAAGAAGAAGAAAGG + Intronic
1106769231 13:32945502-32945524 ATTGAGCACGAGGAAAAGAGAGG + Intergenic
1107264286 13:38533866-38533888 AATGATCAGAAGAAGAAGAAAGG + Intergenic
1107552703 13:41492318-41492340 AATGAGGAGCAGTAGAAGGGCGG + Intergenic
1107657211 13:42604024-42604046 ATAGAGAGGCAGGAGAAGAGAGG - Intronic
1109310968 13:60692843-60692865 ACTGAGCAGGAGAACAGGAGAGG - Intergenic
1109447541 13:62462346-62462368 ATTGAGAAGCAAAAAAAGAGTGG + Intergenic
1109540474 13:63771684-63771706 ATTGAGTGCCAGAAAAAGAGGGG + Intergenic
1110500525 13:76222823-76222845 ATTTAGCAGGAGAAGAATAAGGG - Intergenic
1112164593 13:96904593-96904615 AATGAGCATCAGAACAAGTGAGG + Intergenic
1112717124 13:102199853-102199875 TTTGAGGTGCAGAAGAAGATGGG - Intronic
1113504775 13:110807830-110807852 CTTTAGTAGCAGAAGAGGAGGGG - Intergenic
1115385002 14:32787234-32787256 ATTGAGAGGCAGAAAAAGTGTGG - Intronic
1115546327 14:34467805-34467827 ATTGGGCAGTTTAAGAAGAGAGG - Intergenic
1116000148 14:39234243-39234265 ATTTAGGAGGAGAAGAAGCGGGG - Intronic
1118882087 14:69837717-69837739 TTTGAGCAGGAGCAGAAGAAAGG - Intergenic
1120039890 14:79740279-79740301 ATGGAGCAGCTAAAGCAGAGTGG - Intronic
1121527018 14:94626100-94626122 AGTGAGCAGGAGAGGGAGAGAGG + Intergenic
1121876034 14:97454038-97454060 CTTGACTAGCAGAAGAAGACAGG - Intergenic
1122561830 14:102620818-102620840 ATGGAGCAGCAAAAAAGGAGGGG - Intronic
1122764160 14:104053818-104053840 GTTGAGCAGCAGATGAATATTGG + Intergenic
1127678335 15:61267370-61267392 ATTCAGAAGCTGAAGAAGTGTGG - Intergenic
1128159142 15:65411545-65411567 ATTGAGCAGCAGGGGAAGACAGG - Intronic
1128306539 15:66602645-66602667 ATTGAACATCAAAAGAAAAGGGG - Intronic
1128391900 15:67187967-67187989 ATGGAGCAACAGAGGAGGAGAGG - Intronic
1128682793 15:69663730-69663752 ATTGGGCAACAGAGGCAGAGAGG - Intergenic
1129269775 15:74413522-74413544 ACTGGGGAGCAGAAGAGGAGAGG - Intronic
1130775994 15:86983926-86983948 ATTGTCCAGCAACAGAAGAGTGG - Intronic
1131689304 15:94809385-94809407 AATGAGGAGGAAAAGAAGAGAGG + Intergenic
1131863160 15:96676301-96676323 ATTGGGCAAGAGAAGAAGAAAGG + Intergenic
1132141426 15:99399954-99399976 AGTGAGCAGCTGAAGATGAAGGG + Intergenic
1133553665 16:6884096-6884118 GATGCGCTGCAGAAGAAGAGAGG + Intronic
1133671286 16:8023582-8023604 ATTCAGCTGCAGAAAAATAGAGG - Intergenic
1133893939 16:9907807-9907829 ATGGAGCTGCAGAGGAAGTGAGG - Intronic
1134189351 16:12109269-12109291 ATAGAGCAGCAGATGGGGAGGGG + Intronic
1134215645 16:12315161-12315183 ACTGTGAAGCAGAAGAAGAGTGG + Intronic
1135798877 16:25474225-25474247 ACAGAGCAGCTGGAGAAGAGTGG - Intergenic
1135816815 16:25642135-25642157 ACTGAGCAGAAGAAGAATCGGGG + Intergenic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1138691334 16:58771532-58771554 CTTGAGGAGGAGAAGAGGAGTGG + Intergenic
1139346506 16:66307192-66307214 CTTGAGCATCAGAAACAGAGTGG + Intergenic
1140339924 16:74147526-74147548 ATAGAGCAGCAGGAGAGCAGAGG - Intergenic
1141159702 16:81621080-81621102 ATTGAACAGCAGAGGACGAAGGG - Intronic
1143405674 17:6675677-6675699 AATGTGCACCAGGAGAAGAGGGG - Intergenic
1143451573 17:7039855-7039877 GTTGAGAAGCAGAAGAAGTGGGG - Exonic
1145257501 17:21334849-21334871 GTTTTGCAGCAGGAGAAGAGAGG - Intergenic
1145319139 17:21753186-21753208 GTTTTGCAGCAGGAGAAGAGAGG + Intergenic
1147047003 17:37760213-37760235 ATTGAGCACCTAAAGAAGACAGG + Intergenic
1151005935 17:70435966-70435988 ATACAGCAGCAGAAGACTAGGGG + Intergenic
1151271551 17:73000234-73000256 AGGGAGAAGGAGAAGAAGAGGGG - Intronic
1151416561 17:73969990-73970012 AATGAGCAGCAGGAAAGGAGTGG - Intergenic
1153414496 18:4831760-4831782 ATTCAGAAGCATAAGAAGATTGG - Intergenic
1153557096 18:6326383-6326405 CTTCAGCAGCAGAAGAAATGGGG - Intronic
1153763642 18:8354792-8354814 ATCCAGCAGCAGTAGAACAGTGG + Intronic
1154456123 18:14527638-14527660 ATAAAGCAGAGGAAGAAGAGAGG - Intronic
1155024178 18:21926355-21926377 ATTCAGCAACATAAAAAGAGGGG + Intergenic
1155317045 18:24582257-24582279 ATTGAGACGGAGAAGAAGGGAGG - Intergenic
1155640273 18:28005507-28005529 AGTGAGCCCCAGAAGACGAGAGG - Intronic
1156403543 18:36761586-36761608 AGGGAGCAGCATGAGAAGAGCGG - Intronic
1156674368 18:39509852-39509874 ATTGTGAAGAGGAAGAAGAGAGG - Intergenic
1157237598 18:45979151-45979173 AGGGAGAAGAAGAAGAAGAGAGG - Intergenic
1157584153 18:48790647-48790669 ATGGAGGAGCAGACGAAGGGAGG + Intronic
1157959667 18:52138535-52138557 GTTGAGCTGAAGAAGGAGAGTGG + Intergenic
1159200442 18:65176929-65176951 ATTAAGTAGCAAAAGAAGAAGGG + Intergenic
1159491498 18:69140743-69140765 ATGGAGCAAGAGAAGAAGAAGGG + Intergenic
1160873573 19:1287388-1287410 AGTGACCAGTAGCAGAAGAGTGG - Intronic
1162791569 19:13065731-13065753 ATGGAGCGGCAGAAGAAGCCAGG - Intronic
1163686651 19:18715657-18715679 ACTGAGAAGCAGGGGAAGAGGGG - Intronic
1164816044 19:31204255-31204277 AGGGAGCAAGAGAAGAAGAGAGG - Intergenic
1164838451 19:31374182-31374204 AATGAACAGGGGAAGAAGAGAGG - Intergenic
1165112269 19:33509329-33509351 AATTGGCAGCAGAAGAAAAGGGG - Intronic
1165817074 19:38648747-38648769 ATGGAGAAGCCGAAGTAGAGGGG + Intronic
1167175885 19:47864137-47864159 ATTGAGGAGATGAAAAAGAGAGG - Intergenic
1167904510 19:52647699-52647721 AATAAACAGCAGCAGAAGAGAGG - Intronic
1168683725 19:58335475-58335497 ACTGAGAAACAGAACAAGAGAGG - Intronic
925203155 2:1985184-1985206 ATTGAGCAGCAGGAGCTGAAAGG - Intronic
925259148 2:2515094-2515116 ATTAAGAAGAAGAAGAAGAAAGG - Intergenic
925752707 2:7104192-7104214 ATTGAGCATTAGAACAAAAGAGG + Intergenic
926402001 2:12506816-12506838 AATGACTAACAGAAGAAGAGAGG - Intergenic
927577836 2:24215168-24215190 ACTGATGAGCAGAAGAAGAAAGG - Intronic
927866198 2:26589228-26589250 AAGGAGAAGTAGAAGAAGAGGGG - Intronic
928601616 2:32909048-32909070 CTTGAGCAGGAGAGGAAGGGTGG + Intergenic
929074667 2:38070621-38070643 ATTGAGAAGCAGCACAAAAGAGG + Exonic
929335447 2:40738541-40738563 ATTGAGTAGCTGAGGAAGAAGGG - Intergenic
929380786 2:41350557-41350579 ATGGAGGAGAAGCAGAAGAGTGG + Intergenic
929508772 2:42550496-42550518 ATGGAGCAGCAGAAGGAAGGAGG + Intronic
929998480 2:46845186-46845208 ATGGAGCAGCAGTTGAAGAGAGG + Intronic
933576339 2:84073003-84073025 CTTGAGCAGCAGAAGAGGATTGG - Intergenic
935550393 2:104446977-104446999 ATTGAGCAGCTGTAAAGGAGGGG + Intergenic
936752329 2:115660257-115660279 ATTGAGCAGGTGAAACAGAGAGG - Intronic
937815484 2:126245877-126245899 GGTGAGCCGCAGAAGAAGAAGGG - Intergenic
939038768 2:137163465-137163487 ATTGAGACACAGAAGAAGAGAGG + Intronic
940701216 2:157045172-157045194 ATAGAGCAGTAGAACAAGTGAGG + Intergenic
941454224 2:165696058-165696080 AATGAGCAGCAGAGCCAGAGTGG - Intergenic
941509553 2:166388775-166388797 ATTGTGCAGGAGAAGCAGAACGG - Intergenic
943308297 2:186294797-186294819 ATAGAGCTGAAGAAGCAGAGAGG + Intergenic
945371625 2:209025631-209025653 AGTGAGCAACAGATGCAGAGAGG + Intergenic
945911663 2:215656844-215656866 TTTGAGGAGCAGAAAGAGAGGGG - Intergenic
947073615 2:226318187-226318209 ATTGGCCAGGAGAAGATGAGTGG + Intergenic
947395927 2:229686623-229686645 ATGGAGGAGCAGCAGAAGACAGG - Intronic
948100760 2:235370925-235370947 ATGGAGAAGCATAAGATGAGAGG - Intergenic
948455656 2:238103537-238103559 ATTGACCAGCAGCAGCCGAGAGG + Intronic
1169066726 20:2698108-2698130 ATTGAGGGCCAAAAGAAGAGGGG + Intronic
1169605283 20:7311047-7311069 AGAGAGAAGCTGAAGAAGAGAGG - Intergenic
1170190202 20:13638366-13638388 ATGGAGCAGCTGGAGAGGAGGGG - Intronic
1170974769 20:21151918-21151940 AATGAGCAGCTGCAGAGGAGAGG + Intronic
1171060199 20:21949332-21949354 ATTGAGCAGGACAAGGAGACTGG + Intergenic
1172019180 20:31900850-31900872 ATTGAGCAGAGGCAGGAGAGGGG - Intronic
1172268144 20:33635029-33635051 AATGAGCAGAACAAGTAGAGAGG + Intronic
1173012216 20:39192537-39192559 ATTGAGCCCCAGAAGAAGTTTGG + Intergenic
1173366575 20:42391285-42391307 CTTCAGCAGCAAGAGAAGAGGGG + Intronic
1174119049 20:48248598-48248620 ATTGAGAAGCAGGAGAGGGGTGG - Intergenic
1175136853 20:56830743-56830765 ACTGAGCAGAAGAGGTAGAGGGG + Intergenic
1175485278 20:59341846-59341868 AGTGAGCAGCAGGAGACGAAAGG + Intergenic
1176021556 20:62964830-62964852 CTGGAGCAGCAGAGGAAGTGGGG + Intronic
1176818040 21:13625698-13625720 ATAAAGCAGAGGAAGAAGAGAGG + Intronic
1178158377 21:29881697-29881719 ATGGTGCAGTAGAAGAAGAAAGG - Intronic
1178541118 21:33451547-33451569 ATTGAGATCCAAAAGAAGAGGGG + Intronic
1180903742 22:19393864-19393886 ATGGAGAAGCATAAGACGAGTGG + Intronic
1182738376 22:32547443-32547465 AATGAGAAGGAGAAGAAGAATGG - Intronic
1182799533 22:33020303-33020325 ATTGAGAAGAAGAAGAAGTGAGG - Intronic
1184556956 22:45238672-45238694 GTTCAGCAGCAGGGGAAGAGGGG + Intronic
949354791 3:3168175-3168197 GTTAAGCAGCATAAGAAGTGGGG - Intronic
950403648 3:12790516-12790538 ATTCAGAAGAAGAAGAAGGGTGG + Intergenic
951178594 3:19631873-19631895 ATTAAGCAGTAGAAGATAAGAGG + Intergenic
951595356 3:24312706-24312728 AGTGAGGGGGAGAAGAAGAGGGG + Intronic
951920026 3:27844133-27844155 AGTGAGCAGAAGGAGAAGAGTGG + Intergenic
952063671 3:29541623-29541645 GTTGAGAAGAAAAAGAAGAGGGG - Intronic
953063550 3:39448620-39448642 ATAGAGAAGCAGCAAAAGAGTGG + Intergenic
956281023 3:67556873-67556895 ATTGAGCAGGAATAGAAGAATGG + Intronic
956343247 3:68249501-68249523 ATCAAACAGCATAAGAAGAGTGG + Intronic
958061730 3:88492218-88492240 ATAAAGCAGCAGATTAAGAGTGG - Intergenic
958834592 3:99130012-99130034 ATAGAGCAGGAGAAAGAGAGAGG + Intergenic
958852294 3:99343235-99343257 ATGTAGCAGAAAAAGAAGAGAGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960155577 3:114294381-114294403 AAGGAGCAGGAGAAGAAGAAGGG + Intronic
961414817 3:126749534-126749556 ATTGAGCTGCTGTAGCAGAGAGG + Intronic
961636662 3:128337251-128337273 ATTGTGCAGCAGATAAAGATGGG - Intronic
961951011 3:130749080-130749102 ATTGAGATGGAGAAGAAGGGAGG - Intergenic
961957558 3:130819533-130819555 AGTGAGGAGGAGAAGAAGGGAGG - Intergenic
963044138 3:141090094-141090116 ACTGGGAAGCAGGAGAAGAGAGG - Intronic
963501567 3:146133492-146133514 GTTGAGACGCAGAAGTAGAGAGG - Intronic
963584537 3:147168390-147168412 AAGGAGAAGGAGAAGAAGAGAGG + Intergenic
964415658 3:156444967-156444989 ATTGAGTAAAAGAAGAAGAAAGG + Intronic
965848345 3:172990963-172990985 AGTGAGCAGCAGCAGGAGAAGGG + Intronic
965986503 3:174760149-174760171 ATTAAGCAGCAAAAAAACAGTGG + Intronic
965986901 3:174764832-174764854 ATTAAACAGAAGTAGAAGAGAGG + Intronic
966087183 3:176082227-176082249 ATTGAGCAGACGATGCAGAGTGG - Intergenic
966375842 3:179294644-179294666 ATAGAAAAGCAGAAGAAAAGAGG + Intergenic
966988648 3:185205928-185205950 ATTGAGCAACACATGAAAAGAGG + Intronic
968817234 4:2828419-2828441 AGGGAGCGGCAGGAGAAGAGGGG - Intronic
969507144 4:7595210-7595232 ACTCAGCAACAGAGGAAGAGAGG + Intronic
969925256 4:10579358-10579380 ATTGGGAAGAAGAAGAAAAGAGG + Intronic
969962857 4:10963214-10963236 AGTGAGCTTCAGAAGAACAGAGG + Intergenic
971185642 4:24373163-24373185 CGTGAGCAGCAGGAAAAGAGAGG + Intergenic
971409579 4:26355844-26355866 ATTGAGGTACACAAGAAGAGGGG + Intronic
972006003 4:34107196-34107218 ATTGAGTAGCAAAATCAGAGTGG + Intergenic
972297200 4:37751351-37751373 ATTCAGGACCAGAAGCAGAGAGG - Intergenic
973748486 4:53987763-53987785 TGTGAGGAGCAGAAGATGAGAGG - Intronic
976786102 4:88823339-88823361 ATTGAGGAGCAGAAGGAGTAGGG - Intronic
977518485 4:98051735-98051757 ATTGTCAAGCAGAAGAAGAGAGG + Intronic
977701477 4:100027931-100027953 AATGAGTAGCAGAAGAAGGTAGG - Intergenic
978400063 4:108321817-108321839 ACTGAGCAGAGGGAGAAGAGGGG - Intergenic
978463214 4:108980609-108980631 ATTGAGCAGAAGCAGCACAGAGG + Intronic
979250671 4:118563919-118563941 ATTAAGCAGAACAGGAAGAGAGG - Intergenic
979671717 4:123366607-123366629 CTAGAGCAGCAGCAGCAGAGAGG + Intergenic
982352964 4:154436011-154436033 ATTTAGCAAAAGAAGCAGAGAGG - Intronic
982525346 4:156470939-156470961 ATTCAGAAGCAGAAGAAGGAAGG + Intergenic
983317862 4:166155060-166155082 ATTGAAAAGAGGAAGAAGAGTGG + Intergenic
986918908 5:12661422-12661444 ATTTAGGAGCAGACGAGGAGTGG + Intergenic
987594590 5:19980864-19980886 GTTGGGCAGGAGAAGGAGAGAGG - Intronic
987860220 5:23476609-23476631 ATTGAGCAGCAGAAAAAAAAGGG + Intergenic
989503839 5:42202532-42202554 ATTGTTCAGGAAAAGAAGAGGGG + Intergenic
991035875 5:62126951-62126973 ATGCAGCAGCAGAAAAAGAATGG + Intergenic
991930796 5:71750788-71750810 AAGGAGAAGGAGAAGAAGAGAGG - Intergenic
992137656 5:73763506-73763528 ATTGACAAGCAGAAAAAGTGTGG - Intronic
993425540 5:87759745-87759767 ATTGAGTAGAAGGAGAAGATGGG + Intergenic
993874996 5:93296029-93296051 GTTTAGCAGCAGAATTAGAGAGG + Intergenic
994145083 5:96385712-96385734 ATGGAGCAGAAGGAGCAGAGTGG + Intergenic
995282514 5:110352165-110352187 AATCAGCAGCAGAAAAAGAAAGG - Intronic
996479623 5:123960092-123960114 ATAGTGCAGCAGAAAAGGAGGGG + Intergenic
996930967 5:128886616-128886638 ATTGAGAAGGAGAAGAAGTTGGG + Intronic
997259079 5:132451751-132451773 ATTGGGCTGCTAAAGAAGAGAGG - Intronic
997753815 5:136375535-136375557 ATTGGGCAGCAGAAGAAGGCAGG - Intronic
997958250 5:138297427-138297449 ATTGAGAAGGAGCAGAGGAGAGG - Intronic
999565802 5:152859700-152859722 ATTGATCAGCAGAAGAGGATAGG + Intergenic
1000113609 5:158133017-158133039 AGGGAACAGCAGAAGAAGGGTGG + Intergenic
1000494758 5:161967909-161967931 ATTTGGCAGCAGAGGAAGAAAGG - Intergenic
1000713910 5:164616156-164616178 ATTTAGCAGTAGAACAATAGAGG + Intergenic
1001068118 5:168556417-168556439 ATTGAGCAACATAGGAAAAGGGG - Exonic
1001379933 5:171298296-171298318 ATTTAGTAGCTGAAAAAGAGGGG - Intronic
1003076904 6:2990071-2990093 ATTGGGCAGCAAAAGCAGGGTGG + Intronic
1003488203 6:6597580-6597602 AGTGGGCAACAGAAGAAGCGTGG + Intronic
1004873987 6:19936772-19936794 ATTAAGCAGTAGAAGTATAGAGG + Intergenic
1005771451 6:29077031-29077053 TTTGAGCATGTGAAGAAGAGTGG + Intergenic
1006145036 6:31953826-31953848 GTTGAGCTGAAGCAGAAGAGGGG + Exonic
1006745893 6:36341808-36341830 ATTGAGGTTCAGAAGAACAGTGG - Intergenic
1007920660 6:45606719-45606741 ACAGAGAAGTAGAAGAAGAGAGG - Intronic
1010092436 6:72000572-72000594 ATAGAACAGCAGTAGAAGTGGGG - Intronic
1010293399 6:74166895-74166917 AATGAGAAGCAGAGGAAGAAAGG - Intergenic
1011761413 6:90569866-90569888 ATAGAGAAGAGGAAGAAGAGTGG - Intronic
1011873397 6:91925625-91925647 ATTAAGCAGCGGAAGAAAATAGG - Intergenic
1014087311 6:117362213-117362235 AGTGGGCAGCAAAAGTAGAGAGG - Intronic
1014425394 6:121298660-121298682 ATTGAGCAGCAGAAGAAGAGAGG - Intronic
1014691864 6:124571938-124571960 AGTGAGTGGGAGAAGAAGAGAGG - Intronic
1015883576 6:137893329-137893351 CTAGAGCAGCAGAAGGGGAGGGG - Intergenic
1016461020 6:144280389-144280411 ATTGTTAACCAGAAGAAGAGGGG - Intergenic
1019032297 6:169024112-169024134 AATCAGCAGCAGAAGCAGAGGGG + Intergenic
1020012592 7:4814905-4814927 AGAGAGAAACAGAAGAAGAGGGG - Intronic
1020458325 7:8399589-8399611 AGCAAGCAGCAGAAAAAGAGTGG - Intergenic
1020831123 7:13096738-13096760 CTTGAGAGGCAGAAGAAGAAAGG + Intergenic
1020861460 7:13496940-13496962 AATGAGCAGCAGCAGCAGAAAGG + Intergenic
1022403605 7:30065204-30065226 ATTGTGCCGAAGGAGAAGAGAGG - Intronic
1022530600 7:31064716-31064738 AGTGGGGAGCAGAAGCAGAGAGG - Intronic
1022532658 7:31076692-31076714 ATTCATCAGCTGGAGAAGAGGGG - Intronic
1022802051 7:33786142-33786164 AAGGAGGAGCAGGAGAAGAGAGG + Intergenic
1024404793 7:48966099-48966121 ATTCAGCAGCACAGGCAGAGAGG + Intergenic
1026800575 7:73397650-73397672 ACTGAGCTGCTGGAGAAGAGGGG - Intergenic
1027308882 7:76933029-76933051 ATTGCACAGCAGAGGAAGAGGGG - Intergenic
1028915184 7:96251258-96251280 AAAGAGCAGCAGATGAAGTGAGG + Intronic
1029673397 7:102049484-102049506 ATTTAGAAGTAGGAGAAGAGGGG + Intronic
1030642178 7:112018501-112018523 TTGGAAGAGCAGAAGAAGAGAGG - Intronic
1031129618 7:117816533-117816555 CATGAGCACAAGAAGAAGAGGGG - Intronic
1031524933 7:122813071-122813093 ATTGAGCAGAGGAAGAAGAATGG - Intronic
1031599200 7:123684944-123684966 ATGGAGCAGGAAAAGAAGATTGG - Intronic
1031683361 7:124702324-124702346 ATAGAGAAGCAGAGGAAGGGAGG + Intergenic
1032329919 7:130968596-130968618 CTTGAGCAGCAGGAGAAATGAGG - Intergenic
1033168332 7:139061042-139061064 TATGTGCAGCAGATGAAGAGAGG - Exonic
1034367842 7:150567357-150567379 GTTGAGAAACAGGAGAAGAGAGG - Exonic
1035810812 8:2489510-2489532 TTTGAGCAACACAAGGAGAGAGG - Intergenic
1037839204 8:22232024-22232046 GCTGAGCAGCGCAAGAAGAGAGG + Exonic
1038050481 8:23805861-23805883 GTTGAGGAGCAGCAGGAGAGGGG - Intergenic
1038937713 8:32270951-32270973 ATTTAGGGGCAGCAGAAGAGAGG - Intronic
1039112257 8:34052817-34052839 AGTCAGAAGAAGAAGAAGAGGGG + Intergenic
1039327731 8:36503466-36503488 ATTGAGGAGCGAAAGAAGAGAGG - Intergenic
1039413700 8:37376190-37376212 ATTGAACAACAGAATAAGGGAGG + Intergenic
1039979382 8:42394132-42394154 ATTAAACAGCAGAAGAACTGTGG + Intronic
1040936668 8:52788882-52788904 ATTGGGCAACAAAAGCAGAGAGG + Intergenic
1041142831 8:54841407-54841429 ATTTAGTAGCACAAAAAGAGTGG + Intergenic
1041180214 8:55239536-55239558 GTGGGGCAGCAGAAGGAGAGTGG - Intronic
1041438769 8:57871012-57871034 ATTGTGGGGAAGAAGAAGAGAGG - Intergenic
1042759474 8:72255743-72255765 ATTGATCAATAGAAGAAGATAGG - Intergenic
1044111508 8:88281130-88281152 ATTGATAACCAGAAGAAGTGAGG - Intronic
1044879452 8:96708169-96708191 AGGGAGAGGCAGAAGAAGAGAGG - Intronic
1047048872 8:121086441-121086463 AATGAGCAGGAGAGTAAGAGAGG - Intergenic
1048934125 8:139341346-139341368 AGTGTGCAGCAGAGGAGGAGTGG - Intergenic
1050476607 9:6047347-6047369 AGAAAGCAGCAGAAGAAGACCGG + Intergenic
1051067448 9:13121772-13121794 ATTGAGCTGCAGAAGAAGCCGGG - Exonic
1052141110 9:24985277-24985299 ATTGAGCAAGAGAAGTAAAGGGG - Intergenic
1052194457 9:25694490-25694512 ATTGAGCAACTGCAGAACAGTGG - Intergenic
1052435987 9:28429825-28429847 ATTGAGAAGCAGGAAAAAAGAGG + Intronic
1052830618 9:33212258-33212280 AGGGAGCAGCAGAAGAAGGGAGG + Intergenic
1053281121 9:36820312-36820334 TTTGAGCAGCAGAGGAGGAGAGG - Intergenic
1053290030 9:36873704-36873726 TTTGAGCATCAGATGGAGAGAGG - Intronic
1053466334 9:38311387-38311409 ATTGAGCAGAAGAGGAAGACAGG - Intergenic
1053653695 9:40194649-40194671 GTTGAACAGCAGAAGAAGCCAGG + Intergenic
1053904079 9:42823808-42823830 GTTGAACAGCAGAAGAAGCCAGG + Intergenic
1054530906 9:66181705-66181727 GTTGAACAGCAGAAGAAGCCAGG - Intergenic
1054882173 9:70155386-70155408 ATTGATCAGGAGATGAAGAGAGG - Intronic
1055923988 9:81491225-81491247 AGAGACCAGCAGAGGAAGAGTGG - Intergenic
1056666746 9:88587476-88587498 AAGGAGCAGCAGAGGAAGGGTGG + Intergenic
1056819437 9:89827805-89827827 ATGGAGGAGCAAAAGATGAGAGG - Intergenic
1059035457 9:110749301-110749323 ATACAACAGCAGAACAAGAGAGG + Intronic
1059081428 9:111254246-111254268 AGTGGGCAGCAGAACAAGACTGG + Intergenic
1059244993 9:112842249-112842271 ATTCAGCAGCTGATGAAGAACGG - Intronic
1059447813 9:114349743-114349765 GTTGAGCAGTAAAGGAAGAGAGG - Intronic
1059773245 9:117447882-117447904 ATGGGGCAGCCGAAGCAGAGAGG - Intergenic
1060492266 9:124093600-124093622 ATGAAGCTGCAGAAGAAGCGAGG + Intergenic
1060914850 9:127381903-127381925 ATTGAGCAAAAAAAGAAAAGCGG - Intronic
1061978860 9:134088272-134088294 ATTGAGCAGCAGAAGCCAGGAGG - Intergenic
1203529319 Un_GL000213v1:123805-123827 ATAAAGCAGAGGAAGAAGAGAGG - Intergenic
1187484770 X:19693132-19693154 AGTAAGCATCTGAAGAAGAGTGG - Intronic
1188798633 X:34498384-34498406 ATTGAGCATCAAAAGAAGAATGG + Intergenic
1191848794 X:65570394-65570416 AGAGAGGAGCAGAAAAAGAGAGG + Intergenic
1192622454 X:72692712-72692734 ATTGACCAAGAGAAAAAGAGAGG - Intronic
1192938310 X:75884661-75884683 TTTGAGCATGTGAAGAAGAGTGG - Intergenic
1197159343 X:123306496-123306518 ATTGGAAAGTAGAAGAAGAGAGG + Intronic
1197830271 X:130634523-130634545 AATGAGCAGCTGCAGATGAGAGG - Intronic