ID: 1014430536

View in Genome Browser
Species Human (GRCh38)
Location 6:121365379-121365401
Sequence GGAGAGAGCACAGCAATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014430529_1014430536 25 Left 1014430529 6:121365331-121365353 CCGCAAGCAGTGACTGCATGCCA No data
Right 1014430536 6:121365379-121365401 GGAGAGAGCACAGCAATTGTGGG No data
1014430527_1014430536 30 Left 1014430527 6:121365326-121365348 CCCATCCGCAAGCAGTGACTGCA No data
Right 1014430536 6:121365379-121365401 GGAGAGAGCACAGCAATTGTGGG No data
1014430533_1014430536 5 Left 1014430533 6:121365351-121365373 CCATGGAGGGAGAATCTGCACTT No data
Right 1014430536 6:121365379-121365401 GGAGAGAGCACAGCAATTGTGGG No data
1014430528_1014430536 29 Left 1014430528 6:121365327-121365349 CCATCCGCAAGCAGTGACTGCAT No data
Right 1014430536 6:121365379-121365401 GGAGAGAGCACAGCAATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014430536 Original CRISPR GGAGAGAGCACAGCAATTGT GGG Intergenic
No off target data available for this crispr