ID: 1014434772

View in Genome Browser
Species Human (GRCh38)
Location 6:121409088-121409110
Sequence TTTGACACACATGGCCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014434763_1014434772 10 Left 1014434763 6:121409055-121409077 CCTCTTGGCCCCCAGGAGGAGGG No data
Right 1014434772 6:121409088-121409110 TTTGACACACATGGCCAGCTTGG No data
1014434766_1014434772 1 Left 1014434766 6:121409064-121409086 CCCCAGGAGGAGGGAGTCCCTGA No data
Right 1014434772 6:121409088-121409110 TTTGACACACATGGCCAGCTTGG No data
1014434767_1014434772 0 Left 1014434767 6:121409065-121409087 CCCAGGAGGAGGGAGTCCCTGAC No data
Right 1014434772 6:121409088-121409110 TTTGACACACATGGCCAGCTTGG No data
1014434768_1014434772 -1 Left 1014434768 6:121409066-121409088 CCAGGAGGAGGGAGTCCCTGACT No data
Right 1014434772 6:121409088-121409110 TTTGACACACATGGCCAGCTTGG No data
1014434765_1014434772 2 Left 1014434765 6:121409063-121409085 CCCCCAGGAGGAGGGAGTCCCTG No data
Right 1014434772 6:121409088-121409110 TTTGACACACATGGCCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014434772 Original CRISPR TTTGACACACATGGCCAGCT TGG Intergenic
No off target data available for this crispr