ID: 1014436936

View in Genome Browser
Species Human (GRCh38)
Location 6:121431212-121431234
Sequence ATCTGAGACTAGGCGGGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014436936_1014436941 21 Left 1014436936 6:121431212-121431234 CCTACACCCGCCTAGTCTCAGAT No data
Right 1014436941 6:121431256-121431278 ATGCCTTGAATTGCCCCAGAGGG No data
1014436936_1014436940 20 Left 1014436936 6:121431212-121431234 CCTACACCCGCCTAGTCTCAGAT No data
Right 1014436940 6:121431255-121431277 AATGCCTTGAATTGCCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014436936 Original CRISPR ATCTGAGACTAGGCGGGTGT AGG (reversed) Intergenic
No off target data available for this crispr